,Photoshop 3.08BIMHH}ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+|%z Rimft2 jP<-   ˻vj_UJA7+{ f!S"B#2$$%&''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V#g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~%5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾΁='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK{/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVyi##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋XyߟTƜLٙv5(fVDF5ۏ_"29x] $@˞iXsuCڜe˓MUCE4m"7&ۢR; Ș?tbe(UJE#A"4\ !/)ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ_1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9Iٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(*i;J݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}xox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^)ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}cD1,Ҏh?y<{1މk/ZsIE'@7_ӆ#qmv#%4zKjYH?6I #Eŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛!rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$.G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSREŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8ڂv>ks°`4>U>*J<χ?1H3 'C,aIvsk'ޏp_hU%J ?R3'ģ%Ux͏vk͖j6_TmI۬E3R'ˢ׎7Y[HvB|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄF{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|}ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S}}7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT|(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6xƘ:xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a뀌3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~nj}ȱU]y}L}:}O&|#|{Ïqys *,tFu_vpw_axM>\y:Uz%^{T}zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ńƋL0܊ܟljk2~ nyE]RK߁9F$ہԮ*ҾJQ*]$(}؆Rmv\t׆kJބ980$6Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ61yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr iXϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hbTޒRG}8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C#5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A82b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBet`Y|u]NZLvB@w6}x*@z1y{l<1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ|8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ }}Gޫ2cngϸ;pǯbXRB~{2{~K }4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX VYH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\|ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN?Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w#expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw $}ICC_PROFILE{od΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W- Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ;un4dʬZnPM@FOQ;❰12D&Y<Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞrTS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xktymzyoezq.szra{tOR{v&<|$w&|x}Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq/z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!yzra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R$yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^xSnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yrgqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztYiԣ _ TJ^P ?*4Q-R(L]_%ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y:Ӆ&[!r~ˎho^BS盳Il+>C~3։'ajjކuVq7g]US^ H_>3qE'ʑ rR`傄qgx\d RǚhHtӔ>,3T'|#.eOC3TpT/fc\aRAH[ =[2ɒL'J9 <: ݂oWe̟[圐QՙUG7=h\<2'vǭ ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ .d!g뫮^Y}TO"KA]“t7]-q"^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv˽ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhzZz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mbexThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW=K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b|Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6x-<|y#z|G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~| wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J}AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s(-)PJH@*8a0( Ӕ,jl! UP1H^@{/8~fB0(ъ _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËKÏ"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk ,pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV;u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smokq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?eqV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~1h}%}Ўy}s >}}j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n+o"_qs0uNz'~TJlLmDٙo[<.p4"Rrl+s">unvrx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9=iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:ppY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt'VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZtTؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bEd7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:nuX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H|}~KpՊb56e*9h:_jSl8p@yWbf\"Y(_PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[}JSK}wmp0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkVyBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r;dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psutvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzCi}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!SrizwMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFin|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTlJmA/n聾7p5-$qZ"r4s|i w}'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebgކj/oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN"|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@\e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&>3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖nBubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:ZqlM\rB_t6cbEu3)d3vLfw7o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEzvn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Zm=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gbq|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`LbEdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ"v@zBTLh@Eijh>j7ikĈ/m1(n{orRvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b:?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be=h/mm,t|s@-wX:[3^,jaT%s'd fɈiBrl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl➄osƒx~>d8҃sfx2h,j%l'n$p傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V#g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~||0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF.rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(<։1݈Ɩd2*^|ԃj5kZHIEBx8~(*lǍ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B}ICC_PROFILE3W%Æ*P,f/B5ԟ{3pacKQቌBl3%PgП A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09$^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~}/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{+_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăkt{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfMU1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R 퍖y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcyĕn" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3SbF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PRCzz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ,|t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R)p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI="35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZOAEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k:_0ku'5 Nx.mMآubX.dN—Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN-%q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH|^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbrm1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R-E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P]C؆7 +Ƀ!d8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[:?4ی) ["->wRkߑB<`}UNҙI񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~=sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d"}|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІkKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(|u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvqr'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn op1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz\z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxYyxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixuZy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQ}ICC_PROFILEDՁ>8jʇ,GH!R܏|L]vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*ysԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃH=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c}xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA=^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz:{1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|smtƀ^lv%O w|-@ xڀ*1$z0#\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZr(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx:ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏lzEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N|!|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆMc}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч-J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbWdwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv zvz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey(^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|!~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wzz*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bxwnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{vhlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>US]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D.}>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofqaiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃNRorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{[9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u|0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u!0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$ciXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'}t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.Iz`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf`/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n>e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{Bb;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRyLzF{{ @B={:'|4Rd}m.n~>(#H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJyOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )(rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv$@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rrS"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Nigsa j)Yl5PnHp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'DtWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J`C;d+w>yJ>{}Ej@0l[;n6p1ٌ(r-2t(w<$yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(|$}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0kEArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY|Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RTKU6XD[\=X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz<|UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp!sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(pxtjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3GaBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4\1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ#2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ#2 >6IJPVWb]nbzgkns{炃ytuw{Â#2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò#2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ#2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ#2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ#2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜#3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖#3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#*0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4= 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tle^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wlf`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzmgb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y"-5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3:?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg`o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnhar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz'08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} &/6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5:۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKl}ICC_PROFILELnLnLnLnLnLnLnөɵ"08=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯy of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^gx &- 3 ۞8ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈ap "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋbs֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌcwި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ&5@H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE >840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w'|/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& ,5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegePbpzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]&U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJD>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~tg\RJC<6 1, ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>JX bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.:CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5[AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v:oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-,*****ti]SJE @;6% 2,/3,;*C)L'W&b%p$ # " ! vj_TJA<73/ +! '' $. !5= F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVbn y                  &#"%.:GT`lv                 #",7DP]is}  ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''(() ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > JRUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8N>IDDJ@Q >Z"KWc n w    ')#(/%:#G"S"_"j "s #| $ $%%&&'''(((( ) )((((($* 1 3!1*.5,B*N*Z+e,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5:C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ RPOP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k=eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$ )5CSdt"  "- 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox   % 0 = I Vakt|   " , 8 }ICC_PROFILE E Q]gqy!!!     $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8<<:5&334A 5M 6X 6b 7k 7r 8y888899999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[] ].[9XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y;ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typieb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6COZdmu|؍  !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 33333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : ::::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifghh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i:{gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpjfb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYSPM'J0F8B> >E;L8S6\5e4p3}2110 . . -,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-# !+7DScu߇߬߻zl_RF9.# #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}  +8DP[dmtz  '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : :Ŏ:ٌ::9999-6@FFB? BB,A7@A ?K?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F=EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z:}XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D3* '%#("0 8AJT_ky|qeZOD8-#!* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~$0=IU_hov|  ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|  (6BNW`gnty~   /<HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983-12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : ::}9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R>X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMWd q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx$1>JU^gnuz   -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {   %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9p9o8o8n8n85BJIGDA? AA'@1?:>B =I ~=P |=V z<\y yBEwAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iPXXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3)" * 3<FQ\ixxmbWLA6," (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~(5@JRY`fkpuz ! / :DMU[aglrw}#$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}   $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:oW;yU;T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>MU=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElFgFdG#`F+\E2YD8UC> RBCPBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGAKGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2' !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~}{zywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ }ICC_PROFILE K9g J9q I:| G: F:D:C:B9B9B8B8B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=SF=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBIABQ?BY>BbN9;N? 8ME 6MM4MU3N^2Ni1Nu 0N /N /N .N -M ,M ,K +J +IJLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H}N{TzYx_wevltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmmm m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji&|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s1q8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou}!*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i fd'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:7683818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]`cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhknqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztpm ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yHGEDC C B C xohc_][Z WUS$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q@\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FFF# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f:q9~76443 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - -,}%p)c+X-O-H.A.;.6-0-*/%0!112334"4)414:4C4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:<> @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDEFGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/-----ymbYRMHEBA@ ><:8!6 '5 -3 32 :1 A/ I. S,]+i)v'&$$#" " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(-)6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDEFHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[`ehlosvxz|~"/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca`^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGEDBA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ]UNHD A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;86 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A JUan}   xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !"$ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;?BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:}ICC_PROFILE 7929)<@DHKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu}!)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecbbbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDCBBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H@:5 1 . ,*)( '&$#"% + 2:CMXesrd WMD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 AL X dr   k]QG=6/*%!   $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"  !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ &''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{}$3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'-1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺;@&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi!15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ.@%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ.A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ'/#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_ki}ICC_PROFILE kvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@:=G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv(5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴ $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwmc YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  *5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4=D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw%.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z .< F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧%06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu$.8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hbjx # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hcm | " ,6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉidp  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos  ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º.:B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLPE@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQGEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZhq!w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Zky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q ۟&П7ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ.8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph_#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld\ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71-(%"#(/6?IT _lxtg[PH@8 2-'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbKR a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffLU e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjMY i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN\l xՑ"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD =71-)&&,"3;DO\k|}pcXNG?8 2 -( $ $*1 ; EQ^mzpcWLB:3-( "  &.9DO Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>HS Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXCScn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ&7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ$3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE#?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p      xk_UKC=72 - ($ !'.6@KX hz         yl_TI@82,(#   % ,6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny         '%',5BP^k w $"#)2?M[ht}ICC_PROFILE! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.;C NTU T)P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV\^]%Z.V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.;EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p&% $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&  %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\i u  !! % 1 > LYeq |            "-:HUanx              #$*!6CQ]iu~ ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.///0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A(=49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F.C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{}$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/;EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F0Q/].j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(%" )2=IV f y  qdWLA6-%  ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$*4 B P]iu%! !&2? M Zgr| " #/< I Wcoy + 8E S _ku~        (4A N [ gr{      # & %#"/<I V b mw !"##$$%%&&'' ' '&%%%%$ ' / 1 0 -* *7'D'Q (^ )i +s ,| --. . / / 0 0 1 1 21000////# + 2: <;7$30 0>0L2Y 4d5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u:rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{!0;}CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10/ - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵyk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'"0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!  " /=KXdox  , :HUalu}     ) 6CQ]hrz    % 1?LYdnw    !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 33222222%*4::7 20$254C 6P 7[ 8e9m9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^]_"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d:aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v;tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210.-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) '3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d;l>A(A6ABALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q:ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f;dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e mt{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 554 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rutrunu+iu5es=`rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& ", 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!#/;IYlρϖέrdVH;/#&4DVlvgXK=/#,=Rizj[M>1$ %7Lby+9GS^hpw}(6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / =IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I7P5Y4c3o2|10 / . - +} *|)z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l{  {ocXMA5+!&0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7*$0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax)7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~!$2?IRZahntz )/,'-":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: }ICC_PROFILEuGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{}}||y}nbWLA7-## , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5( &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw|)5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]QI?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=QKZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4% ,@Vn #1=IT^flrx} -9FPZbiotz~(6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""  $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x:t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK>PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y {{{!{*{2|;{D{N{Y{e{s{ z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx  &0:BJPW\bhov}~|zywvvv  +5 > F MSY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:aM:kK;uI:H:F:C9B9@8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?HL?OJ?VH?^F?hD?rB?~@?>>=>;>9=9<9;9:::BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC?JJ=IQ;IY9Ic7In6I{4I3I2I 0I /H .G -E-D-CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~+{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_^ ] \ZYXQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpruxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"%1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6*$3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz%0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj  "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y XWWW  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q PONMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P[[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz{|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{}"*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4(,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a;_B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfeb_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O)L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::;7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E DBA;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOYOe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTVVVV& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw#+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj|z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT xt pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ XV%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(<&<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCVCa Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGIJJJ%J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJMOPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUWWXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhw}ICC_PROFILEgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz}*:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~#-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWUT SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2|1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVWXZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_`bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjkmnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{*@VmRfFk8q*x~-E\tˎɧMq?x1~# 7Oi$/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][YWVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQNL LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5F3N1X.c,o*}(%$ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y     wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *++,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsuwzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIHGFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ TM I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@=; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+()/(6&>$G"Q\hv    ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%#!"*1:CMXe r o`TJA:40,(%!    !'!/!7!A!K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&&'$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx$.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G@ : 6 3 100.-+*($')&0$7#?!H S_m|p b VKC<62.,* ) ) '%$"!!' .6>H R^l{} m^RH?82.*'%#"! &.6?IT` l {   z i[OE<5/*&#!$+4= F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#%')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&'*,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@><<<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J?6/)%!        $ , 5 ? J V c s qa SG<3,&"   #*3=HTaq n ]PD90)#    '/:EQ_ojZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!"$&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4:<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖 28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb! ( 0 6;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê!'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ#%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ).2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9}yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt}yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt}yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt}yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy {u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ |v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ }w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm  & .5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nuqi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy to}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy ur%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz vu%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ wx$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z #+3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6<@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw!(19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' /6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{ Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ?94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=}ICC_PROFILEN=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{&.6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2:ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth iz ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\XXgt }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY\k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ_o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[b r &- 5ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1<D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE >72- ($!!&+19 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[gn"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x(z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& .7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhTfv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1}:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK[j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]VP IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE >82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $  ")1;F P Z e h h h h h $'#'$)!09FTao| !!!!! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GPVV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _%^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+:DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W)R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&;F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|:uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!#) 4BP]jv                   "%1>LZ f r }     ".;HVcoy           #'&*)+&7#D!Q!^ j u!"#$ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//01111222222222(16 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}vs!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y:S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9E@@G-:6 6?3H2R0]0j/x.Έ -Ι ,ϭ + * ( '&&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy   seYNC9/'# %. 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@N [ ht~ #0=KX e pz     ,9G T a l w  " )5BO\ h s |       $& + - ,$(0$="J!W!c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^-j .t /} / 0 0 1 1 2 2 2 3 3 343433333+ 2 :A CA=& 814?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dh}ICC_PROFILEjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqpr#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s;pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\%=#<"3*"$.9F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q""( 3 AP]iu~$ 1 > MZfr{   ". ; IVbnx  * 7 E R^jt}         ' 3 @ N Z f p y  # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5566666-3<AB@;6&767D 8Q9[:e:n;u;|;<<<<<===========3:CGGD>B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t;~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$="LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz   ! /=KXcnw    +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 FR ^hqyڀ؆ #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R<\>>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e;bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S>NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J4S2\1g0s0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4)*6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  ". < IU_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[=b=i=o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U:SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaaaa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr<^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ))){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy  $1?KV_hou{  *9FQZcjqw }  !1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_=f=l=s=z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR;tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +|*{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+#!$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,  "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6)#/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~*8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;pf;yd;b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?If?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZgu ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7( 0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j pw~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{U:T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=MU=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBCPBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGAKGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S/R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI6YP4YY3Yc2Zo1Z|0Z /Z .Z -Z ,Z *X )W(V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<}ICC_PROFILE|E|O|Z|f|s{{ z yxw u u txyj[L?1%# + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E:C:B:@9@9@8@8A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=TF=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBIABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:- '0;HVev{l]O?1$  &0=K[lqbSD5'"-;M`tufWH9* +;MbxШzk[L<-);Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~(4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m kjiih ,131+$ "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJDGDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hGhQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<,"5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^hegmewcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSSR QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{&2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!" !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"mea^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E#E!F F%F,F4F<GEGNGYGeGsGGG F FEDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNLNW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+ *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U$S+Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZSOM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3(3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG GH H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VSPPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg  }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMIFD!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA>;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0!-!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515:5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;:; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {vqmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vme^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B@=;#9)7/6 54 <2 D0 L/ V- a+ n)|'%$"!"#8=AA@<w7m1c*Y$NE;6410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&).)6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HDA> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mkihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<,%7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~}ICC_PROFILE !+3<CJPU[`ekqx%-5=DJOTY_ekry (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA80 -+) ' %% +$ 3" ; D N Yft;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr     ?DGHG{Eq@f;\6R0G+<%2 )%,5?IU b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;::::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My-!6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHHxqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== {rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:52/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}    9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{=BEFEwCm>c9Y4O.D):$0'  ' /9CO\jyBGIJIvHmDb?X:N5D09,0('# %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@??>=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn?vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b>d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk 1F]vagzrib\WRMJHGGILS^o]',T|+QxAb=+Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$NRT׵i$Q%]2]>{3S ښWz?/o?yixǿ^S6<=e^Xy$\[ehu1c(d8b#NX}ӟbmpҕ?m=x6ܓÑj:u (b6?܀)b@?rqIVyZKss[pe`+CPiO:WϯI3]3"û)ejHj d&D l>AZ[-OiP ]؟$z?gGԛ~oq<_uchwkr$UA7g+ś<t>7(TxMx{{+L5 c6}v9Zq0À>?oOocn?ی؎ts{>:ч[L#oP?_l:eΡS^#}cV?TG:Ms8^3 AoFu^?nxyΙ|Tyq]?'}&7mWz31x[~=pE׽nlo{qr8?Jӯ{ҀH ͫϿ^T?ï{zSb ޼NE:AEͬ./ks~]i3u}꽸Sqn>~z?}[n@a}zX_޸4^ň {^Uꅾ4H?>;>c={j[GֽQIV: '#~_.δ?>DrX\݂?~^}:~BSs?=h׽˄_?ޛX;Ary?i.8қ~8넟q0+l|JUm _td2H7E{}]%y__gVP4$_O|',8q6'-+i*A4cI(KzEGƠGI#?Pl˚\]t -.A \Ol< u`:g[]KAJH$&Vڣb65эs9xʫAfv"ivoRX;l7VJΓϳvVƠwlލcR8qrfaI#@cj5ڜ]VbnRAB49x#XVʙJ'P1Ĺ62Uʼ|TL3(>?c_=vFo]KSUVVjQ-DƉ<p#{3/[Ma7[7iEUq\\~GI=g Is|=~vFRƯyb,uHV*-|fY}z&TJ_OG'Z"P餹#Db>~@" D_UϗUcd(`b&TS$@N]KrEyԱUz^}?7;*!T,7\mE\N V@z Ɔ1Dv!Y;v kd62,wUK}7 ~bIX@)LSˀY2Y:MA>?Ǣ[i$ԻO|dq4yiLnUPkOUQ+Dm!`J4!G+#-u%Z>JU:LLQG3sTi=??LxP)}8Ϻv5-=;[=1IE-F:j^M+!VUBp^2ʱ͑RtU<zE$*?oEp.*E% uL6W'/k&ZYI#ztklӟ+ @PZ^th4tW{ xib~ʛy VM*$4?C銧REAowʠl㒥nʫj`pg=^xKg"}_MlØe-On:ˬX0^jQFb"1= [qͬJ>1PxyQ #$>Ǭ.r 9!YAFR$J,G>,-*xfq HҲ?~P +_kJdsBp5T55ҧGČ$/(`B DiR:jRCI K\C?-b}0CkW1P^]-L/tW:@!h_H\ AnP_o嫠tG0}+#IplDzJ S l 5ǍM1z,DuxGlHDj(h%lTcC,~i(g_$ٍ'{(>ΠWʭJH֠sPTR@J4 /͏=\y^/u9<!pO 掟u_{tׯW6C7K ۏ=gjrEϾ8??v [ӫ^_|u~mϻu? ]x:?~@؎?m}ѱ_pDP{<IoHz:M$g]~>_WƏ\u+up?O~??_On#XP_I%PA`4ߏmCǭ~E9{iֿ"5kMȽ^x?Oi_xVzI<>=g3ׇ׾J9>{z[R{h㞣UA@ϿS\)_lZEǽӏVz~0ypOXu^m#G.k_o^[cQFs֫~7PT?_s<ǯV}cTZ {F:Ffە,gz??S@[D*]6)?Ƕׯ,.y'Wngׇ[uxAcϾXnukry sQ׀k=6H&?T.__W[|p8<}~}?.z^|]M[ci uA~,/*ɿc}z_﫝W:K kmӃA׵cpGUnT$q>cʽx0o?O>F8u<>}x^ߋăIH+Ȱ=?uaqkG "`>9ckm=EI\???O{=n|[B[|H)f#׿NO{ޭXx!ׇD^JCkc>RE?oZPz,RXsͭ?>_}gՁ[~ectn?CnxuY ?{{k&peŅ7qDZ|E3C7q\VTOx@G9+{L"+=Ϭ #Nj_?9or'Hߟ:{+sF~܄RaW+׽rB4 -`?ۋ}H^%f F*,y{5.ڤ?N_O[[Gs]yJ)ы"(V6?~NjzB?m:ƟB:צp/|?_ u_ﹿuQn~~^?{,Vtxĸבc`+=?N9{ *[O#5gq_Ǵuo:l5oǟk^EzsqCj#rn{l˫Rf ܐunɷ'5fH؃ς@\x{mN~]luq$ܐ~OӋC>.Lկ~66EowSQ"O| 9#lxST.a{-[,_+״x?M&׽=/:$O}EPiQ_o_?p_o|>A}.ok_44q׸mn^{։!a<$_ u`xu^׷.IVuoߟ1+aB׹b}M}k?B?[8U IM׷t\u??U'TXzQÃ&'q{O?=_l@:bٱ~]xqn?})zr/?[K{{+>Ǯ}un,.~O^x`Cϭ_2N\~ |K ]ԛIoNַ<{l>:o~E[jt߀l,@"?=PM=q"\aMqoz}ےOm?~?=Sb^?Ksp{||=u` 6$ X\ _z#׈׿~p@ o^8~ ,:Fo{AC!Bq\z:Rۑy[{`yOa}@NH[zONz߁*Ŋks:]Zt^~:y=!~ -{o_aƫ߃=֔ꧮ9+7?>N} ^/|67*‡\B F!xuߋ^?|ZCcqSڸp}l"ɨ8kXݯ[녿O^ Mi,/c ?OzCXGǛ}=?D~up<[{׏]}G# M\>JS][867*T][QWWua]9 ssv6^? 58=o E|8P?sӟtBO^ׯ`HsO!nGXZ*<cßJ kJޫJ8@cΒׯV#>V-o=qf7'eGO|Cc~ `u6At5bLuojs~=R4z^o?Ca>߅cj~ï^+;^~}ܖ/\:ǓŽ`96$_ӭr:HO}+AfswGk5}?"X>OU\8_cи6:V߫>OuN>Bc"q_߬lCzCzr8OޤZ.JuM7K~>X ؏97${~?{θ}z~ok}AAOh~,OH&"}Jqg~>‚tn$k[?ի^Ϳ# Iu'EؠWkׯ ,,?j"_$kՇ]_^~#߼]-Û2zXGr8_m:][]?R Fz\yKU*A_os#o]A%[q߫WdWڿ?>}GHmQeyAteIDbG?[X{$e ?:5P?z/%yPU.sſ6ӒX`=Wo~}W~JP:|#aCO>~]jAN q4w@7iI'*y" "R$<sj֙Ȍ:A'NU7%GE;xLdD6\ZfN.6e@pxif ?˦M.0fW-(Yq jr-e `qsǼiB6 n@n?Ǻ>3:Ywh҆KYtĞor5Q X ?[{ea+QSz>5xHWk4O2Mk7ҶWҗ(#sYa\Wf>RDB*nCEݝo|'Cq׏m+qbT~6>ƙM/:Ȭ98#fr}=SGz {Ŵ$ʥXtoG"׿<@SP7XComX ϧ>E $2$6~sar' 8{/kװl>[G~οR5u?/u*w6~ E,D` Ln9?}uH $I9J},ˡ[?J lHV6 _I<?{+=6I2Sc~mn?ܟB5؟W3L@U>^S'k__g5=4v/aߟ_Lhzi_aMTp}:5-Ҋ0BPHB"K?U%zM0$c/J?߃j^ӗ>csK?>ϯ{)ac}اT={o]{nMI/GT+&a{/AlB.pMO5=mXڮ-^#M~?qmKr}E,ԸV'ӛ6ANb9B=(WԊ1jtg}9GϲRoO>M媡/r^G >G8qtvԱ?L@?8d~8x+۹us{~i4~i528E*b?peIڡhE#Ǖ@u1#X?ݴQǚ;<"c4WY?R$[876ϼV K*9H?b6؏k4R8O??t f>|z &b(xؑߣB e{MWP%2r I`<}?}XnZ8'^NFJ<#A鑂UP16'#M߀[_)q}?ڽ4t[i.3Ɛto 7q=9DQz㞹{íAmsnOD~NKcn/j{L'1-sȹNJu}Zb@l14_׽*T>I/zQMx~޽*/žK}}Sϯ{OZ?{)թ{Q6 &\Ǘ^Qa'ިOcSLzu|\ ?{!^9b[=v5{@/O~JhzQ׋p?~zTݺUyTyiLu()׽B߁ksLuc{Z9HUՐ@O\.:QՎsqd~}#jup"cxPm7؛QHj?i{Qi F='#Ya#ȵoF]V!0arctǏ#yWi#Q7_jLtUYi!E2%|%?H*m2?g?W S%M2k-HlO:$<ٔAiBA"H#4Ϊ}JHu>]YRq%NR#uK7 ~H>IU=,Q8rjoܹ?p/’OXe(Iji&g]4 l?'=wG`)6frnQ2YHG$qKrE͸`4$%1uݷld7el>P<'!]@Ԩ &豯jcM}2HƮQkn XXO珯ZBp?a,Q[W$5 .$}3痾sX*}\ܰ:H a:nzwdeT=~N4Xw$+c(7y7kAS4UXh)rrGV=7TidQ&?o[(ћtչza2q=jӏ/EYax .ͧ@;`T*0o9J"]MA>$[٭FLnjZ+:+?TH5ǠH:~lN*yL4/=VZ P=- b=;RZU2E_h>b?ڷH-N?Tb.~&ESO ?#UBKŞiBQaP.yjbqQchܫ&j[{x9xÅ8]REN4>+)94oyf:m`IԑSK# G U$YDZ5eM*E?P0ES냎u ZqPC'=m=p⪏7Je3QDX7W)-ffA!lHJ: tIU_=3GBq#.a嫟7>Ux:E$ޢ V8ON%udiƏୋ)HDuo KN`ybIr??nܥ iPcn []IBo,t©ϑA/ˤvnGIeՖJ$HFJOdbu_: S==5S/1: (h\ >ͮ 2x"zq:p-"a\'~]'rZkr}]U'UbszT;}í'3QT})K>Q4_XZ՚ݵɲ[''- 8SϪIx}xlX3E6;jg7DѧpRIMW2!wy[!ԗeQ:;>j=v\fS}z01.\q%kқaw%jWiNƟG{DZ{ǰ6/z}%ȨuৼBrm]bIA @Z姴*Uzu.׫5o*rMDi eRE.>>N!db*IG Ў.fCIǩw(:҃uRٿ/:zO>ʩzEyͣ)ZUa&T?`u\vxVJYJuFt3VFP*G7*NC:jb C ?\v={q;k!erȓ("Sr&z={w?5#:4Ua?6<؎F~۠:f^յp>A_ǺGq/߽WNPy~Hࠂc8c) WXg4땇}vX@z^SOJ'^_'29Ӧ[mx>`p]ٸ^=7oRnI76GUԧ?+Ei?"zNӞ9=Rw[bEn?}:^ĕ1QV-ǽҦu_G6Iiíuط?lA>un?C t$$\lGqu~"׮B׿?$c}noʓ;{ ufPpMnQ#6@׏鎹[ڇMFqoǁcר}Ouk(WG=Њuk~ ơh3J}j rЛl>yy_;s}Bk_ވWَM0<ț qzSW:nA1[{4~ C%@o~<O^N \q^oWo-?h?~=u'Zֿ?$;XPְ6c{?u.mq+pkӐn~=z(~]{$Yžjc׏QޢX}cIo[߂ZpW~~{\kkyShp`Zjoi_+E 8U::չ<{'4 cw}Xqj؀'y?0}?ƽ֝z]_ ?:^bXUUG$mc?_uX\Oj3֫_qq87(?>\IfzclD+}_NJi@s_kԃk0?CϸyՋ(_{jgT/ˬ~?}G6hɌ`1$z9n N7½+%q rK>Ϥץ28d2M%irm6?kJ$u-OҤF84]$mmQa0{Hji`pGE:~H>*G8Һ=:X7׼PX5{jjx\:/ej23 %{x.9={ۚ <ؖ-cկN׽hcZw c>[ߺѥ:QJH'5rQM֥SF }],A*+ׯo UDUtQHLgU@^M@_u =>ac3+QtSPGډ_]ƿ?aQ>ka4o2{=ٸ'm 0 i^؛܀uX؞>GuqlmoXAcoО?˭箸?7S4qzlp%soGpKoZ1F%X,٬O=q_ſ6Gc Gg+gMs5/ǶuͩO??@괯yHk i7*ys|=z4뗼 -{=҃Q}T, H -]z-(cB텅߃u=tm}.$sځ9Zuo o'uy=1juݯcq{P7XZ9]?X]qa}M@\zc&ַoϺ҃ˎ?yG}}kW^m}>x"[o{}ۭl>~o?otZ!}~_Ǿ^^lOןǿS_V]n}}qe[￧iz\}= 7FMcN׿?-}P)<\j}m5uӯ[=$}Mԏ^ 0 8u~'@->gZ4NfM'Ź~aׁ!oů{s>7 IG"A<ԤU\}no{q Su׾#>"OZ^}0 sSm&Rj~oo?,7 {<ޕA^:-=^ }mq)pmbE[?w7(?[X?ә(h?թ-?׃ŗ=V~}iN6}>JڅۑϯTzߏyTnH ,G׏ݽ؞O](Rʪ 7ǽ uoREYskx??_W^@}cztlW?O|5[ޔ ŽۏV^o}z$=ɱB yr;.]',}z696<}B*vz]Ͼc:~Gߛ\[)NN/̨ĐnOZQS׳WֵǾWMp:9?$)!@ ^y[MË{>޽?x@ZHDuWž_ [?}~}xO^&crK\/ak}PH7S:Z}{X/?R87~oH:^/kZ\AKx#O&t-C^8׏\OO-Dh sW>}hmO~ v)[n?8qxugVnG_ۊS׭p>_|X6c?Om_.ӎ?M` .޸}ϻ>q ~ { y$^5ӯ}ٿR.?HͯnSu7}9uz`O[p/jas`?1H\+6z,?ױL2_?;/Pji%~B%-#-c!6 ,ui'6^Es~}zz]RD>^I @lZBxuYadžrn'"S W^KHF8.IիN7:}@\yY9^- |'[^=rGX2K2h2!~uX&i޻P4hknVҥ ?XKkEō6ߛ{t7ħM+OϪ)館XhhBSj<]VO]#zjR㙊[P8{G,~g"݀}ԾSmMUh@E{nbڱ؀d&A< oYCR>Ε=ۥǟQs~8_m[(KWQ?^_Ke*~B1YЯ*S9U[yak}<8>EDT[Ǵ5cjmW^oM[sn}F)ק'_a5P<x}Ϫ o?;4߶ı^O~qR_q{~@dN<_~׬ZJP?krj9Ztӏ?RMt${?d_9N++\=׭O {N__z=k{¦H'$WY={lNM'ޑA#HjkyS^ob-~>A&_.tٷ{odI" ~񵾞꭪jdIsuٹ.3 A7!ye)2Oӷ?b~k-oC0\{Ɵsj>\}kN^mVDzqWtNFM!x>}2UY qnƁyZ#Jp(+ '|4O{Si㺆X|G ?[ܭͦ|dQCS4\#ߝ?Q[d b+8H5+_ͫl;(iyh*յ]ukG=:m$>:Mh,f}?MO{>^] ԩFڪQe҉vQw> B3 /qqϺ=ԩ$ߥo~}rO>'f<8EKo3ϲfYJ}"Ў?;sW=z|UOlavIGUg:aȷ#! bI@0OL׮?{mr8n?~Os y?p]ʣs}G2VjgVnwo'nTI&jouQVTӬ/p%6MO_^'#I A#{_}ԶS{#?^xo)ϧu|/qĞ>X.:-_ҹxޣs6GߒUdp={3Ӓ{Su}yxKH \q#}ZOz:t^A\\}1ӂm q7^ڥ:c{Ȥ:QGWW>r?ü+=>>G^;,9_NW^.3po߳Ձ^ڲ#Kϧ8D|>1Ѫ9> o?=uzztasRGh(-{\H}x%u'ˈq`ڦE+(["ˮF҈ai)@O L]$Lj# e0Ǥȶ_~y6RSPbjjH8CtW,w,Ҡ:M  ZW=zj]q* =2M;h(䧉ALjՍ*iuٿ ̕ݿA=-Rx㭯𢶐'Z %]*K$ePUX(hhA"} #' Vs;18nb{㵖0Sg I&^#>I/D'},7_|UNJ=MqTI[4Y2u0ѐ$0* dj!_:P`̥M4HZgINlz+Gd+7nțnǑldfBYd@$1b88j<&"yaZ1^jy'qdh!ڏC 3N|!xhg|Tܝaz?. `A~TE <=CRŦZ|~)n {fM($塧jjZig2[L2HH XF*/"ʢCR"8x5lk( rE+_MYa6\P޻avyLevt1*5CFi&Xb$+ЉX#H*ߨO$oeShi Qh1 pzPݓA vj4MYG-MSWO #Y;jkgV, Dkqq(k,gIKtE3??>}un-q1'uK i#u6[ۜXrLIK,de\_$/כF#S1E,W*T=:`)aRhꇃKD=@\>}\+CZ>2Uaxxe9,J#F#C`7,C=R9boTU M^ rT]""nTPFyQ _HRWIl-R5C5u>ړ' TFWT1'XȰ6>ɗʋQж_0\kے-{EϴLyk+dph*}ұT7FzTXcƤ=Vp3!K R.=Ue2%)@ & ,ojIyS^]$fR|jxu=*iF;m+l}ti+>okX=B:e,'ԂuBzzUCrM[ZQYM qG~nāΛ dg F)SHL}U,VP~۳iް$s>8TV jG`$V9EUGbFzh$z@^U@1P 珠=W⦵/O,!?'l2+5./1&ӨޞiZU#Q!VkTS¹%@k ^VuUB8E? /hb ,MqP?,t ׇB[g+2[`+)%GJEIśE$G/]b4B$+[s+ xᐻ=v e#n ~yH.>1qQJ_zQOCECdklj+Ƃx&dCiHķ?RVE0zaE[ iOm⯠'Ղ:EEx)|DbFCg_bSI{N#$BX+c6f=HRa{} ŊO!P)l0i-fֱglڙj>u1z>uHdڇ!(*#8&C]XH z,Ů,(ꍗ]A#VCQ 9hV+bt k rUφ( |DF+S0S0{<~c OVԙJ< 2w\ Xky M?/1 ="}2,ȓkGK[91SԺYDo䲵`ES<2ǤA*A^ [ϳthɦ^rKukm__qYK:![@(3~e[8\y{`? }6^z{ḿ}<m9ކV&rn~_{7:S?կ^}&5_^7OC׽C.?W=/E<{ /꽉q{?z5O,&^~9>)Mp=/|vo Z<}.ӏ֘?ˮ$mk_)Ǜ 갷[mZׇ^ ׁf狂/pA[{(\'>񓨩}ߋ==:~=c{Hh8tSˮI?BI&?Z:+.߸u`)MCoB$[ӛîVy6$>\V^]{={#؎= Wׯ{ٗB~\Oz".|~{?U7\p?|[uyXbHA?[:]Xq![{:{koKc(zZ%/k\ykϾv _qGt^4ӭu|E,ēbc{GI+׹?|[>OӟZ^q6?̣W-}Tܓv`x_a߉|:G`Iskqo'߇֫Nm'>׺`4{a>]hux7 i%o?yqH~}{z<$ Y<~~߉^\cd"knE^Ҧ\R#>f62NAP2?Ǧhu>?\{!pg=KsQ5f%=ײ-\,m D2 % QORA A.vM!i^:~~_<Օb$B è؝] +-V~{yĿj2 T̔ʐ;ڥBɠ/7 j*x7+tZpZR뎒brtw!RaڨK?|UbЯ: -\RpEGaPakJӯHקͿE'}UӏǺ+o\;N;Rp1v7o-O(QĴ.19eHUl̆*,O4K#HF-!5:O |[rGMyǗHlLul4jXuU?_~ݻf`d*脊;.UKH;zUE_dʹ=jJU]USШA5\.}7Ic? t7jjKjCW+wK_< o'׳Ԍŭ7Usr'ut&0}7x{c:z>߾ϻ)s#/7oxPV<SӃK7o9{gE:)@AEZI{G݇i׺7~6o@M⺙n=ķ*oUͬ?}Ԓ3:}z\ޫ[oOtEz]Pl.l-?^oov<=:׽Hj}}8_]smXן?_϶]n][{k:Ak-"Ƚdc:]~߫r?~}z|58'UŁzP3׫W?OK\yݸ?"Ӈ@1׍a?O~ԅ<=)?g^a^XG`oo?L3g7 aMco)=wK}o{8_4o"O~6cG7"ہ꫐1|-pH$>qm]8]?_>ay{uW^}/o}9Ro6jëҘwbX$z kq??Xs6aozU>{o/݅iֈ:8??[=*$r݉`z~ruy>qQ}vM~=ۭW= EBk{q^8 -*_'&_)x_ە?T>wUl5[~x<\[?ߵP׭0?G}՗]GϭcQ.$oG}}k״ rG?2í]_Q$isB=n6zv?~ZdŅ?׏zlZ?}r?z:M:} @e?Ϳ=~~O}X`8\\}?Q׿~qri6?[_=d>}9No6ĕ 7?>LJT6 }\Z1l9o>Ƃv[lX h'Ozg4^zK6Q`WoŸYuz̋ X7}I\_/?׋Z^~Gn АAqCuլ?}1%~ >}?HZ\O/*[A?oa9?^\#GـeA_ßvQjiOK@*Y@6_ϽցzpO_o}H ?B?mozlqu^9'q<= &?~mV>&=<]97oc7<{n!Fxp7oCc{>Om.?zf\i 86`>۱zK[=lt[r>j.P:O|y~>ןu$f=h/^&r ׵?2bÇ^^EP+ujuV_*\ѥz\0y}}yq{/snDs=zuaar \+r9~:X`S6 Ε~Κ2MLyί?y ss\:=/uAj_[nNZ5H+SG7^}ڇTŭOquԟ.q_:zQ}jG0R#I-ҞfrkO)7iI}z˒5oO{fBYj>~bWzR?htEI(#FZ71t6'Q@WR=R@u؁<8<+~yk=qH T%TNÅ 'ƪyi ֹ[8GMOZӇꂾ@@]%q% 7POHru؀VɔcC*OpaE_(8zpWՈ "",R5'AvKrJ[PQ:=.Ek}8n}/XUՎS8ʯyF1&%`TKU@ I%]#0:y.??6O?ëYe*M2K.e]*\'#UBZXه {[8.=PQj# ܽqu]EmVTRKO›ut_m%e1%@%x <@grt4ۮA[Q<}/~=N`yrNO7AS3p̭wbJf롘~>?_`5y׆ #r9>8tX ty"~=PmEMG?a; t.9zU6:r$o{S⺯N\Eq}ncӯ$*m(A l/{+ܟZ@tO}w_ Ͽ/.sԺ{E;.O=w3NH$cfU4O^͏ߟzxIy>|zrO7~괯^ҡ#g=x u|z`|u׽DljM[ێĜu&Vone2`d ~t-ݟcq*޽זr.Gs,ℑA+I+3şɳ!ݔ1`ԯ~}Ώ$Ӂ_=N\%j΃}қœk&0ݩ5tR4q4[k~q8CSAx }AK8fjc;9}$%yY͍6_]qD b(_ꒂU\#ji$|<:>|_:CYǎ D4<$PI,װqǺ#. ]F >.O[٦<QuOhۅ2'צ\ތ;-t*i, GGnmf~}m76?G-W>SΕ7?C8'5H=?}Yγp ^5~?۟f\s5-[ Ď?nݍ'U=Z<^̢52iOOL?o[]j,H|zޫnIQrxAkK֐?֊,qj$jGj#>ep6-{Ϻ>EGϪ|kߟ1I|}7L޽{blr-ou=U^Q=G+)1{E<?^síRMx$_=O3׽um#{U_tWMz`o'ׯ{ly%OJuZu}'NLn?'I8=9^ȸ?K_n-ӥ~\>(~?I?׽ʅ~XVaJuc.)^#{گm1#-_i˧`=žx:EcZ4Ks>/Gc%?khzo #lsϵ tIdeQfs",tbCQI?A>^^qǨz&BaS;luC|n 5"83y4)hzA*_Y/5$AduqS<u{vS_YhF%<1bHL|[{pq5"8%wfmξ-.i76SjؚJywwrɔ1qJI՝of:XR+ [/QDgT1WGKS! ./0O- {'4qeuHLtM.1%+tޛϷU''7mǽ:;ib1?0X#_7dɒ /ÓM3@Ā͞Dk( l>6;XcOC  q{ }=ۺzÇG 2Pb] =E;(,V6}RoMU}EQ㣨YRKW r{ʚ '5KX)tB3SMԫF47|,RqT[Hxf= [ܭv]gػ*ʌ 34T֡O$ EM}$Đ ɍHvvD1JP}{Z*kZjR?,q}if||n0I}E&nY]WXEYLV]!GZڈz)ETc0.m>%E q'HQ஧D̺E>JvKYh} P*Ŵā$MϽ p98iEsPjqyuohw&)78l\&c%k R0Ju#"u#*h(ISkp\A\ܐ=)'?=xԾO=)-5c 靮3M +xY#ZJAjrSiIJ3kosh#ՠm#1Nh0?m?zH??oZCSSPVRe?4|ADRHࣳ'5n¥2C㐼2)B<+լ)դ+5 פ|h?>`R3Xc*XX݁Wy U>̖vS2VҘ?>h/P45_FGdǍ?4vcSCȓ•KES5n#iV)kkh $D0y4nawkt;fS%2fM=d1VF )XdadP-<IO:}OAUQzQ A[\I~T:M*p']FmUE=rʃS.'x`$0$o99 [9 iH22'Gv2q{S:bWDuqleRWjV_&R!+'=<#(bUUSi*՜L2DCdJ on}X*gzVtan9玲Qo91?c)Zj벵Phޟ:j%T1Ť& \ͩ奥fyWbWHb\zAAspV #i\#';>>-MTӲ<aŬǮd `$kQ|"X'fxdJ2p[Ȅ7L< |F?M Zp*t[[s IK9KYyB`yq}$B.Y=Z!,1TD*ԗ˒~ K `4'ѴrWPjclUmdGKS;CT!yǓl@X!Iw?UUI%HMLjTv\77L5厉,*+inMϋe4#,Uu.>7# Swv"(42ܲ }@4o;"X4Ztl"TOSOö*ip99;k*M4jF]gHˡ%!6#}U2l/Jε&1Z\'qב Pq!x#?oM<'A" ~D\l+h!zMzBڢ@/c$1>'8eRrcBi!iP*qkRxA$wiEE+ZV5$pJ ]ӋxI*%U01b *_bl9AA;ҦYT-AImk,02Z I)6ohqc CZgud}=: Z1-4`ӈ>lG3GRnѥ+M+ĞJ $K$UӢGL";}]+vE.>i"d^5P$*bY~}=IBH+Gu/`ݙd`a h$ӧHQ$muea3* o/?mu cO#^[?>qIo@ְ_>Lwե}Gï{Vį~- `O}uj#orG xa֐X7k{vS=Yt^#׈O`7?Ƿuhu^}6axW⣬qany߃n_hZdǯ\n_~A>U^7 c!&j˭ix=!xyb!dʖ obzs_u茶M嘆s^gk׽?^m?Vqd?8"Tui!{׸܃uz?? Xr16nq}r<}kX*ž?[XX}9aZuz3[Vֱ<y=iQM:Ma :"zu5w_Ͼso{lu|z:Nmo߉՞ǨOP}8I܁ksǶQ}#E`5s=޵:h:_|zyMk[~Tg=uz}ZKP[ȽV8|^}6k\H [߁:׿޽pҽ{'{,C-?'>~_.$uiiVk5^D}_ \㮸 Kٿ6s_m~,.87\b>^~X:# ~lu__׽}{~WUVs}n <؎=gZ3:_r8o}W~rugOϯ}@[ GI~}lߕW7pms8WĖ.?J-Ϳ> AlEoQ:NXf/Z97c׺&bxu>޹'Ӳ7/jު]Oxr|##kǽU<\??R=oUtXīeH%S~?R"1ݜ"$%}|@M)[cI{vK_wmC.kWiD}f2IjXmo**k׉) $_>^c'C3SUU-Amz+ƼФ|>+&1%+Vٍn[)hqj>t]ixVuZ<8|Nn|yrj.hqM֥C"#K!Hf^wpuN-%nͬHdIYfh2kVp念uCP zyttf4 DQ&|OUӀ)G>TmæۇtUC馩N:`HbfVK;?./nV#o閒Ž1`Ӭq䅹7>8XcZ@$'̒jI'&I#jb@PUSP~]lI ԔO[,-mHEfB8Af'J`=&D-)׵P#ٛ<5+PVj'}I"%(h0sϛih+ZmV|pG\2ߟoxR_txЋ4>Ί5J!SQC-R3[jN>{>XC1fXnxenHf2 !7q#-ܲ`A\~G5ݱWP~!#TvdS>}4׌Lz$)y>ҟ,>3|>oyvYw mSDqyg1VHDJ o$"9^'`RcL^p##hԂCT4> ߇(_vmnLUv۟/dprxJ%zaS4ZR$ުaPisP#H:B~?2z>tMhL@[ zhcHt)(H+QTOzlYik B{> ޸j#"2x&,A'sac{}/[܎O7p¯_J?Ϭ珧~{ {u$M:?OoW^]4Lp}>mz[*x8?>8_կ^qqaa_ߟzV˭("ɸYW{Sߕq#_g[][k(orN|:^Q_jl,tH->>|zsem*B߃0O^=tXGSۚAWW'E/#t<}GV\p5E_FGS~Wȭ9E1}>ꌾ]uԋsﯩ[=t?=ۋM<z/^S{B6[Ͽq<~\q[Ojӭ~ν [{<Z??^ -nyahxW=[:X6\[k[ہM?E+_?_~1o{:s׀뿯ן<}=.?~]hӮ.?M>\I<>Q_{z`x[>Ϩ~$/߻Ǯ?#OƑ;)=W8_g^ bZ_~?{OR?*u?}MOoj~EzǦÓ=x~n׊SȰ?OWg=xSqoo[}+r^SEz|96+'= T_~[I+aP׏{huk߀4?OT:?=G]jз @uӮ_À?゙-ݯ_߾7,B}7Ou.i\7k59?.u=X"[)`Wxduo{sOs6u_~]p{Ҷ%y:H6\}Ԋq_?ïq{`˪>UՏϭQ\~OKRlI?~=Mz4x6[k^ca߂?|=w}3r:tI<\A"d?:$=]AZnM7}}X7z<$[?BU߅/|_}%Jb?M??z̎?P~|9 VpbOt+ÇWV8oqK~ ,?Kq::#߮l@;o7}=s}2(Moo?ߚn{~I:Q4W+X\uG#רY9}l??]{Izmӏn5%qߋ{R8pnGğ7Von?LEG^O}р >_m gZ뿧=a7`*l?KX۟ϟZ|a5c+`xۉ>3Ik76#_:ECs]Xӏ^! ?C>_> n8$ӏ}x׿%O$[9ǽ|^덿?Oʭv@Ts~mo~]q#ܨ#Z Z゚=CӮ'?b ~?ȸ.S v64}ton?g{@=Bh:Ul-rS@䟯ǑguZ:WYrAtE.?o,_/N>u~ޢNT!] @K1 Q'oǾe쎌I&@i%}$}on-DZH yϭV_u&sd4=A`n[W!2i! _N"O+@s_*>]Y%}\p r / n=wdVecw7֘$p=6x$A2z֋QR>6i5:.E43#Yc7Q&.In.}@p"RdTb5]O${E|ޝnf 2Ri#.ݏy҉m{n豎 tqΖ"/eTNAF_ؘ7:+ceOIl bIH䞪쁷K(R(y$?ܕB>Lh>)6b%KG<C"kXJ\ NP:zVy#Se!7 \.?_' 7i@k4/}&" = {-Wޤ7_a>AT$܎?Hx!WЭDsn (ӧO[j)Sd?[ya1SUqq~x.mڑä+rx}14c_u-=>RUi [6?: X}kOs:@+v}mLI~ΦS}A+*̷;5م:nJ7: -+Ft z;j6-~]z{x8aUZ={5E{O?hg{@cՈ{r?W{㯛>~xأr4܋}.OŎԔME׏p[ ^ Y8aH?O!'׮J_{n.VB |\/lӏNw.;NV(pjqONifQ`l.?RAPG]T=43ӯ{o~O^ۀ8_~xU8:w\oſOm\}$`^T4Qo#ރS׽'?va.>g׽?/P}ouz[@>~ӧJ}?]{D$2AX׿/[Ⱦڽh`{dqa# ˧CPQxs"<IdWru {VmBZֱv^ۻsNiOYa \&5)}5>Ь뎪a0A=!E4MR븰5usԬIe9*@h×#=~z^ktƟn1Ñy|]DI *.1+*ݕJ N O?xt.UxUTӽ02SIY5`"Q1R$+1yX*{!%H5aT*O8/,oZ8WIzOH?>|z 5lI<"O 3uYj1R&KD9*_Xl=#z/4Y :IIM7;qpbq ILTuϖ2 Bahi^㊓~x3?V+nl'n4,цQZjd46;_xڵIWGWEx;GM45 J$u:AuTq΄ǥ"*Á# ߋ2J>El6)s,׏'DXg*X"5xdS u2ApUmF.& -a$2^4ŅRtJZ#'68N$zg_ˠ#zޥ7YmP=nljiQQHa!_pR2=*SMُ(.Csa~<>.xƑC5?@nu1.%$ԠU cϥҲ;T _Kgo>.)W6[ZlvZifVi%f''SRjiұV"Y :e~TUbjrJHMF X}n $9 PH<F>^O*}:ɜ=&Zu``6䥥aV$6UhUA/ E JW240XcG:KEpC}A7L@#?z@<|tw :uRd_LټWZ1 ЏU E FP=L%y"• ~6`mIJP)£_P+x砭\ҘZoHdW֒$QҬofau$E4oQHX9҅_F 2(~9[`G|'?5eZwF(i'&Ft P2e!-~zo jP|"8SOJ])B9㬬V})"}ZLzξlĒ $1Z^@sAPhppE/«geSʕI9't÷NJ Q+ UӰDR9[HHf!C{DֻU%y \rnI>%(Oχ҄pzHɑ_^vؤQOG&R"0ώu& F4ci2};RT5CTobkDTH?ܹ|5g^<q5I#Ξ},091U%Me T͆QO1ʀ8R)j e1uMB6CO醡%)o"H9_MHH݉|U,Q?Wl=W[xyTvGwckV%Cgr,Ȉif{vgpRctSjJnXr.di& g^t[} 3PIG?\'v*Y^ܸIqVmLY(byji܀89AvR9fk y*9RUWpOWeYm+58&1_>Wh%kEȴ^lt~Pb $C7(Hi#<߮gi^GEN;xc*8PALQ4P <ط'g<8S`V ׸]92W/- |Ed4D5Z"̀FTSdjqOE+>A4h?^F2?gMr*@u#K୮hIi*)WR%@7jZAbv%*XyD^Bu nogROx}?垵cAqV:\`{+&Clͯ)eUA@$2$k`x&]C,l!Jiʒx -H,F#~yێ 9u&AC;<=OCÓea-W}"G2LՔ詩j\FK45XƉ~#Z\f+Nx+1G@Q'S|OK#!8Sנ|0A^FTm3QRVL}< S&EKG-ki(!hՅEmNj@ӥlIގok{G(2oIWעwwvPQ+0C3=<%镂Z=L1(IFҪU)gkVD7W#P|\VgIf@rh>^=iFjxeNcHDuS$Z3eY؀&ܘxq̱'hC28e ޓ):Hn)ZA*RϢu.Ҽ|<]Ε$G ],QvK5r! jf#IZ-EVJ)b=1i.+~ݓs/Ta/s_?z;~#>bTp*l*,3Ôjzk,UX ^`=xkj&sٹkw`GxP?=q,i)a5E6%*A e}ݹ;Go.XmA4US{4HM[c6FBECR:O 4 Q_MHG*OJxy5Г|2ﮬ<_r5鷦˕%r% bL1j7@c5P&F">+b= Rcv%i{( Pߟgp>ZOZn0->㡰OO~޷#)>>|g7Iwml)fj+nb22 O֋EO,+jEef:vU<i'Jz`T7RS{<2G@8b~>G׏NUqo"Ƭ@Ñ<&8da 4T~t]#r2}^z2Iq@~z_;,Jr)Ǫ 0 kSLEI?}}x@?:xΟQ ؔ6ۋwSW=)~-k_>ְX[]_>P箂ۑ5 Cb-o=n'>{q{#aO^8j}\}H }@9?z]}㰶{Pb-9}V1T>ok^ͫMs姟Uv.?O~"5[a\_'XO^=c!n-76bEԱ_I{{3:m{ I$[8AֺFpInn>=u-x5Q*AGQc_.+^xz{5W]ۓ{}{(_^<[}}?_Coy^`@\}Sar>[ϽҜz]G6ue5,6+j?Aê׽[ln4[M+׀?B@$\[qUZ=^I+u??u ^ص^fo[7(PSG׏ϯ{#M/_~??ï{ .\6o?Ks u|~$_KX?+׽ 07<~}׽I뫛?`qE&܂Kq|{ۏi:ozh{`oaֱS˫Wmbu[ތ~H$|+iF6H(>#:)c;¤QrhZf|s}EiRqB>x:NxUlWà|tW;ϼ^3WDoGMS+Iq/guv,>驏PPbq=h ~-Š?޲}|۔GiŸ:z6$km\V.{ =ȾEIǿ?pz>OߛfX#hX4m-6?>쎣e1˥ɼ:|5]~ᯠ@C]>Tl? &_5aoC:MoԂEx=:psƪI:*]/hE(cfrZJc_R`f|H+? m$CYEU>MMIwP)~/^6kԉ*Z\gbOԖ]QI!$Z_v@K`!@?^/M$TԦbjې|׏ڽ^7[Zp4W4~o? xt}Ma@|[q,8ϻ^{ ?M8uC6C^?_Rl?׵ϿTװ:>ѕޙHeÇO\ܟxx#~r<-6znW}8?O"+׽NH~*[{F[X?V܏:}A`p:ן\? O qS^z|?_=W0z{ Ajr8 ׭Ҟ}v9Po=pPߕu[ѭ6=C=x W'$_nInƝx頋,T8߾C6xzmɰ/ȹ1W&>SrW {c_Oϻq׮ߩGxDf^>>6?"SScǾ86['߼꣯s"[>>{5l=uo!?qDkc?sހZQCNOy_νom+am8'=k{[xDsnxW?77ki<{CnO^Hupyܟ~=q5m܆pB@ߋۋpg'6[?}I<ۋr9{Wqa{_}moPy_~8֘' ~6ߟm}:*k׀$ `^9T^?SZ_s|:~_IrPX=׿}6ذF O~Gź_~'?':|}x`=ݱNG^ᄒj6[.?ӟq:P~<">9oz|:[QrnG{5\z#Ȁ'PNӟ# Sֆ^ 7.7!M?^ǻV]y?<}qXk^^{zG_{Ksͭ~9Xs?Ϻ ?-ǿ6\}HޏTc{ A%o?zڰ'^_}&ās}[9ۚg?_yp}d}VmZqš~}}'[O~l?}=I\[?=$$~~??ӯ[o>) Vt\Gzzn~_oVv[Z$}y?k~yM>޴[ ?=MĂ??q$s0~W_HߥlGU:^H&:T~u<8u_|ǨX>5{o޸>GׯMxOy8!O7kou F+Zn""=7[tYxA:o^ylÆ\}\= ^X?Oz]{d _co߃>{I9_3X]51zFH~aon>߄ҵNƧL0OZ? L3&n9{ :y(KX[)^? fӱK^tӤ+D!Qv*$ʎ8Y~}PQtS^VTb1(hKhKAaTH,\O76K}9N1IOpgttc$)0&kA~I s"-ɸ^ӏƗ1垴`x¨x@Y=\X,,8iȱ4y[BuS<+~Ȫ\z,x$*1y rZB2+{ꉷ{fhg_g^a2o4eVB{1 X' 9U4;x*ll _Ͻ@~U<+-y7 A\Xs0UJƭj W^e%)$NE7ky} GJa"E(#*Y|؞ḿXC#<8c\z~1Ӝ8b$(̍kVuHK 6*?[KXk-$|ϟO2$ S6F],O5sv?JXR]<rtJ1oRmCXaK h-9>ŵ}h7^[=* ypC-ڷCd}.?d˲_I mfG?rҺb:-CFp.O7diSv/+qnI:1 ox6)_<:Y|;8zcIoܰ@87>~@>UtWo..j?qEuL?S??#^F,Ϥ qڨsJV{Dx>Bo=[xumծ’NE“v=жi SdW8kqϴjǩs.97=^׽P>>3׸|[-u^.2A:nϻy>~^Uу_+ё‹k{bj?,zef5]S b(!hv =VǛ?Ttv! ŝPo_b^ˡܻumlo%WKM%XVҬynD1<Ճ]83?3uf6Yӹ*1|#WL1,$ XvI0Q[pmޔhhjA[I$kP:if"`uD$,o$ҕ<8\YʦVPW soGzZ?%WRi3[& i*pk5BHmWacm>)RMb aKի 'FhҮj!I5ПS=H/2[ZPޝ6X1 ܛYjN6!_2Ե~m8hFI *lQ`̓qbjY3k%;FI(SʅHR['!pIDXܫDaGSA+ǏUY=?hwNfj|{S:UJ\uwQL$KC \fyn_ۘy!'wLT,;eTEJȱ,*I?ON^Vyhj(48鎇9=%̯mݘfcwi)I*|eܼ3*zjkZ?Ml gFY(ƒ>g5ӝ/[OfKnoMY\6#e@8}Pnּ.()a8\ԬY`ͭ=m/]\u>/V$q#=B $S+|!WZ~.OD⮫z~۟1[vVm\_]ek)[A4hV5$%Ty S2T4E폝/c`jt=4?nSM\yjP6_or),J{1QFNr8Ȣj\QOG'OtO!1墧iuNR--PewYȽ%+(P&ߘuOڱ.k{kv[)q1iP11q`B_LAI'JH_^ "(@ 45 >lI՟ʛX:z𝳚o ~+Oy0M2yeQ0g}7#S#!}oߔYR)ZZq+1gJi kA]xE R$㧻M5ϩu"@>kC#uV_%~4u'{n:—82aSe4[w'=dƚ4,gYVѪۥXFsu_.2(D-'Mq'si8y@=4ӉWzvR޽צ޻llJh+lySYK]YKSGZm4H8O5,MW?,PF!rC,$SE,X_Ir-e6筫l2 :֩ ÚM:Tra b E]B)ˍIlQT6Ccsp=H 4jx ־yU WpWˢm,J} )jcZ8/-DԡȑRʑ582Q}<8 Ӫ7$&HVП'fasG|ze^\~]bvd2T"3Og{㰔֧}JDY2GO.i>%r: ?iY"a⬎Z< K5loTS9qOT veOH*iL~[kE"2v*?5P=CKB!5}-G4X8׈-~C:K+"9H=k.>gqPq9j O{Egb U,^TtM@-He:{}jGx0ҕ)N?M3ē3whQTTLdG*B/{K6q*d~Jl4~xؖq C$Ht:Sp6EhGWҞR٫W|7/ua[VZy+i}# J@(pV4T~t Nq|4+^9%Eqxb&ۘ>Ks)1V"̴tr*) I]Ы,]6}\9졺U`9/Y2OҘ=z JOfyTC-]Xa6J3÷$b"HH$$"Ub⬊yѮP>DPB}6^}МCqn̬;GZVT?>')$ P2 >gr)N"sBe)aZ蔥EL%jv9?1YJx2ճR#ͤ(I>{/tԕ&Z8.SHn#4~nǴL`_nڷKc1yU52eZhR.=$>1V(ei䧆6%mkORMx@µgϥdW.);gpS,e&fxĐQ6E\Ms!`ߤ ߏo^fw6^Hㅰ`xp@s@*@Gŗ+8 PĉE4hI~?@8$=ǎ5ʆ8]. Eln/vkGc\>d~~GtMcO #Lyh{" [ro{NFbJX ic, f?K}niɠ&叞stӊ`].U61ɉ۲TD\TBM3(*K^ǰc1c#EI!ȢuY'O>(.HhBJO<+ס( 1(Ղ-WZQ*AWxPT c67箚Cb cd j~`gx.-xi}+s`ϡtP ݘ\f#%(6?tCB,d8ޞ)d9cWXpGYW|}4aA1d@X>U=3Îгqo,{sTE#u=)dqTSA:|ޙڪгP ܀oG>x$f_]T_Eut5ddE1E!tPAɳU4f)RmIO]@I/J'<hSkS_Lu\WǝE?ɞθ]9uUQ}`RbkLRH*WUFu}dBZ2R"FNb,>G S5x˥RD4 zػ3lm,V,DI*#OMY:-=*r$!r 0߄}W4}M[sILrM@_&H)PD3/[yOcbo:I S4M6=oԲԏhd_JW'{;te!Zhwj'БEO-GLjiӯZ4ώ=J]ӅmU:󏧑*)sꢪ"Š'Jg4ZiW~CՀ <:ܓSu0SőPK v Ud*YdVKOЛ`H<Lhn=a{?]Pco{1%S`ߓ?~~K_`a>:#{p-n.~=g$2h5zQN}"䐺%o~mW׸|}[%Gu$?Jy:Mxj_珳8 +c&kb}'M xan|п|I7 ~H^myO^xZ_6SϮ^{O|}xߏ|M{iڀk}?a`Tӭum{<K}EoO#l>/𲊏p]xSkI"?\nu(DizaQby?B?}~'ӯuy A  mks{j#={@oMk,x`x {X 0(8?_^JW\by9o?siG?Oj4huW6{0<^~{ֵu{<>9=}z|> _$uzߏFÍFaoOz׎ze] G}/?u׽{ n5X{=z}j$Eo߇ZNoyߏ{|zeToI{'@Cpߋ\uy|E6mT׽IzpO?_??~'[׽ 6 }/p~8~ϯgׯ{6H"ͮ{cpIQt?q{?=n{QQRy[O~ly\}ƽZW={;}Is?ӟ\}ʋ"ܛXpmk=ui׽r8oՎ:k׽Ł_y}ǽXu^Ⱦo7$z Nzqji[RO?VC?ֿOKs<5pGa?KGSodZ ~_7?ͿEz S9?dEv$nlTI~nX&HBf146WW~&{`hƞ}H(SN\i7O?ہQæe^GFR}=Fk҄]"{7jUv. 9 ?_u=x}/aZ\X[ϻFM8\(ڤG< zB\l$EyF?}/^̅pؐ>[կ^ z p_o陋^-lUvʌRM6c:0)'c`?#8"+Ky׽Hig7e ] ~WC*.O^O{<: [ ~?ӡOM?A&=>>ouׇR(̡~[~mz:菩׏~G6}=}x09~y-D8N8oDza'b"bZN}遯Z=wfDn?I-r?ǎ}Spɿnp뗼QXz垼G^Wz9#(u^/mZn~~aCN:DXj$ߓ#u7Sb:ma$ߺ ͉?ڔ8Z\O"Ăy#R[q׀?P=_S/Ë?ƒg[}ok?#%[=w=f'-kOӮ,M.8lċ_riXS=x[}=܃_s?uFWſ[5}M}4?^[_c{inŸZ:?^=@#sA=z={{ϾW >{ua˯?\l,y}o`ִC+O|P{lNC mKu׽0^>ᄒZ@Tc}Boȿ7˞~?~$~,~Z}P1~}{{/v'B{Pvy{&( /Euk>S&NueK h so^A}_K cEa}=덿?~/-{/ϽWQX ' ~xx_a$>?}/Ƕ]˫^o|aϤ8#{ڑ?oZtA$o}qֽ7lm?OǷ@տ?͸q7$}>~ot>?#DU<{boZ#PT~HnHniցW\? k9Oxcg^_}r/9Xx^TW뿭x76$Oy_3N_n {?]^~λ#?䱽ֿCׯ?:?Qoa?G:`׬?} ډ,ODz#U]u?-Ǩ$?Qicz%oUqX^?޽G߃+[O]9Zܥ$Z߅[>v"uk׭x>}gaA՞tx7!P>@?^?_vBcϮ6ӑo-1rX?G98yzs㟥C l8<^>XgZl \s>,KsksakVz}:sǫ/{?WH>μ8u?ȽY[+@ }8/N[zc'ğ퀆ᆕ"X7{/ZZur?"ߞ}܀ޢT5r$~-F'[]Zō"ض4׷:rlmO捤Y.[o|+NZuݯ<\ s/ osomN'ׇ[t @Q_헡}v?\lXOǽq?>.>*պy,o=Wu|Л'~C$ /~o׺8nx9[&SО)/7WbatQ(} E1U5?˥p(|͕'wыMH?<~&ѳ\:=4OM}:kHN!tRjH̢vS˭ҤtQx k.߹ooU9y*N5 < Ho͹'>̇E6rA502Qz}f\$5Bn?W>n?8{H_{M&0Op?>c~=KHC {sziiIoXS/G=:I]7<AoWLŋۨ?AŪ˩—!Kfz#9;YIx?_׽c*oցFzIW޺^Gmo{+.O_N^UW'([NAwVs_ieOO7Ld]^/7"!ҟOP< 7Zna qo}߆$Y.*2ib5H}/쓖f(MjxzW8Z诙b E-/^ϼMJ6"I-T nJPd~i.@@F[~mvf'H*<~֞U5 @JOzݶӾϩdX"es{6Ǩ\:LX_J5:G6tsZugĒ7 ?⟏է^_S׭x>?>F O.DjJ^A`TgqmUͅǽӭh/ n;[W\=C7Ln>9/゙҇"״)GM??8u_'{Z6uU:a?O֟TH}H$>甆\N0cǭS׽ 'W䏯Ӫׯ{ rApߛ\q>׽BǷbBXвO^}˧UC-??/{6.6\n%*V*Zs&O!!,x$n}_/?FV®XbU@䱷F^۞:\fj'iL.Nh)o;L^6W$oRk0>ݺ3dqAJ 7f^ZT‚z˜#jV}?_fvGjl=ۄ6µsWQ92iUvHI#6@{jA<%I-QA6=zԤv8QE>vgfWdqXg_N,f5ZeB$vDЏ"ëy-ite#58j%2X钡Y wV =/A#"3T<(q/Oo=}߸JSyn͗]%;͆t&:ZJ|WEZ Qox73%IpeFس]ۈVɌBXں2X*elRHW6]T M8|-dYJciU8Do,-w>>e{;M.8Hnl6?20Zn?ehx"f-3*5{6&H*V>hKr,jSM w+TC<IkQ*!ČM*Thxڟ!*t[{3[^An OkS͐͊uPUoU44MjL4<13<|PS 媨PUC pӴp:IxXT?Eb {%IQM )YUSt)4E,(c{DЪx4dTP@iP(u>w|\TG[6*Ybm›ohRn V9SYh!_$2*CR ԣOvaSvb<=md)SIln6Y"tmf[h*Ԍ8U$R5Ռ^ fo\fw=O*s "?{FǪ&A2K!)(%ȱzΗo^khOC#ɖijh4QeK!Gc 2_f5 q uqO5#{5Oe;;w`k7^ɸd㎟0e*HF)5Uky$0=7m>r AC*+񻎔4 )]4J8H2V_u19?Mxk=Pp|P_s[37~=eՊU4Iɍ' 2Ak0lnㅨrqu3ZWfYQ'Xt_/(I>b'ևITcT;Gut٫s=FSH)⥖gRV3`T =*)IKx,Y@t{pܓukCP43~[mXrYaRDd&QA4Q$UX[JDi:m]B?uQDUF%k 9y6IR+,2ȭN N ꯟev&*a7cY z*^亟"N\+xn˚d0T,9% _ rlH~}Q\<s۳!Hp˪ԩ-:9e85,cP$ZeC=RH"=J{zƫ\r9v)|X_U?g ӥfܐPjcBҬ5:Z#"KXoaUeBd)!RVXKIqnM}X'O J%Gp#e#& p~tm7W*qXǒof뎪&;|F鶘PK>6DpQUGM FK&EDB/pǏtTrZcyN?ZZVAmCquU bSWԼjqX/[`=#o:ID"yCmؐZnMDeckkS&g5L/>7Dg'v'0cizy&Ċ3Y-I{{Bҥ`jhas4uU ZXKXY\ܞ=m/g9ky,U} vGOgk騩QT!4juTuF*e01UL sTbX }AY~$<5dTW+}iAvĥMwGWi;'8R:~)WHJمݞG+xY`2I#>nl>g! jjPJ PS˭J.@>SQ 3cp[V!Wg+ bwDy(5QQKp`TC\ZZ: 0%DQ`kx!s ,T.'RALP $zb?>,$V>gc]7.ޕUtMUEV>wlnQ!SPcc $Z H/"D88R7*gRERu 1}1*nĄ6jPZiJϥmӑT`%@[;Y45am*ىGᆬRʷ`g&zI?򙪥iु(?3YQtM݂S&I3\8AbKS#$7;7j6z>$Uk5?\!sZ`eqP$R8O7ySp!48L%EkTtAvWA$փ rGDJω?_Y7@dcd+Rύ~d16'luegMr{{W3K+yjh#l_o\QPSҗG-EMCM7zviks ZZCDgPe`r3G:<1Nr@xHnEٟ/HW fu4s=oϒj{jZypURM4zJ4<8bfrg7[M\MYM'dSe@a6k+>ǎ1@|O߆<3JFE<ދ+{7N7iⲴ8X)} QcFyU-T|j;HUxy!;*n*bc[KܵTv,0s`gֆ1RW+'g#q}zcNUڛzf14{n' ǐc,XjQXM $fۊPGJ#$cEemD )2x?FVV`?zK txAfݟI`#zj4IjDJڽiXcXLMٓK]$D|M LN`ʗ$.~iٚ sh> Ӎ:7>;OF᥏9)#M z9j * XA]:mAdrWy^N4,Akooo'qkAtG{be<(1k7rvj-DU{dG V6[T2OAKI¡J}D }d)(3_}IE% ( 7M?bH',f С>=7HpO 8z.8ʍ9Blehd_2EO&2l5{w\}~:VnLe]D*r^2[KX#nH r;_Pi"0\03Ɲ 7Lo!Qn텔>vHhiq<+4~[i21OĝT`fUNA5$i"X#qt'!B#PGN$zzarČh`Z@лp2|(tiT*uB-;0&: 1KƤU{H>Ro~d>㞬_A{\Y7YEnmx X0 ,8^ޥjS_.צ\8>[xQoןy˦l{}/`sXkה׏]qY< n9oſ#GKQV8]\Ca[~m<ތkm?e+_{d/=+eiv֡k}>-{kӮ׏$& ͍G[{xS׮8?KnBى {Z'VS#7 >:\[ܝWuqǷ}{J @Cooz|b{b,q\ҽwX)[}/_OxoQ~u\~Gep~<Zuug*nN@{ߏ^luo7"t]D 8zW˭pߟ+ٮAq>>¼z}͸Ԟ~#'?u={狋-l= ~ 7?~4u][{{FNſ~Z>ŸIG{zO>)I"]??_`׾rޑa[ïKl X_{[{%'He {^{ߴ+nߟW޵W=z{߇PMF:׽\^A?Br6[Nz}:Ɩ7{^@:,>׵g={ߏ"9~O?BO?O߇h5={~}$Z}>x >zuֱNG޼jU:]qꍠG#8at5i:_$"XًW{s$r*W*ơ6Zs.Eq.}I.,?~/Q᢭ iz99:Ng_4YnJz괘_H/?m2{Cs~?iB? bI}{^Dȷ{H궞?^mo~ uS`^o>.n"ڇ:ğHj6IO>Mz?n?{:^7ßS[W76jI9GOkp-{in^>b|:ױ E?W׽QVZ_~:GN~>fK{^EXanmԩ{ߗMnT~<}9^Tkdž:n$-v݊cׯVzSYCq~"}nטu߾\وnׁ=q_ƛXqrG׏ο^78usC\&Óo?ܚ*\G}$#Pߎn?^ҾOz}nMō9oyԓTx9OoU)֍_WrY)Ou*k׬{vso{=~yu~&6oI:{joc?S>~~ubGև:[ws>}H߳=Z>$,I&Ï{֎:k_Z{?7\uӏ:|}?<?{[]}X>#d~Z{Qc[O>2g o[_I qki{3ϧ[#Gq~[sbmas{S‡z[5 ?>/n-zO?g^ā}}߂p?y?f=z}.y%a*=kM\O<ٿޫ{/}~}=}nqjֽ6sQV[&OޛiӪO:ߏ.@<m}hs{nypH^A=r[ZuX͸?ǿp?gO"׮p-?S{b?G@C׋p?o>/ ȸQOsϼ{?KgǷ_]{?*?`k׽6Oqyp8aO׽,6"O{Jul"ǂ5Ψ_SU!_~'oPcױ}CMzuU׿:}\ks u}H`AHn,ߏqևsp8 Ho<{qHo׍ׯ><Qbyon^l="rm[zA~Oت)<*y:{G @$}H?Shsu9>ӤNHUͿ-~Ϋ u^Qo|,??-~g[\]HRtUsc/oeZ:?SoyCbO?_=uq׾q:HfH Wxcu{}@\{ab0~8޽_>N 7__0?"Mz`<8]xq:?^kpy mr<ϫσ[I _P׎GПk׉_`{M?owjuu~}l{~}zu=3sk,Eҝ{q󭁹x߸uO?Q<2>ǻ:)_}9sJ6}mJqp7LL.͗D_uo#{[m|AӃ`5T<'wWHouЪt?&7<^ʾkZ6J $I%&^ 6}ش%Ϩ?ՑOtqzVÏ+l+D(Bڔzllmaq B\ O jVឝTҡfMq6_DV]o ]q]1@'?ێ?%]&Cpu!A<xp}`!y}{I4Fu#v .8#(/Ǥ8w\~x`ھy[ꏞP?+3:]/[?{P6zvb77~5{e-:|'g'Ӫ"A_OOCGo'yXIt8ck\OzU<L!kfYn?&^}[o KA.{ qapzrKzub:TnS6MM:\qn?^{5]{{,O{{ݩ-0'ǿ7H9*U%@oM'@(~ޖƹ~r=+9K~?N? _>'/S}v4A[5# 'cڑq==*>RZS#@g`F?^ЋXERAx 9Z7rx֜>g?̦LSJ(]˖b[$:[}}ɖR$mT+($ oUM?^S8q'<1ݸON.G7Ԭ&^VȠ*#NGy%pǏbz.o>ہ[iڅj~.>>3-oX{}x_߃ЏM밿?_pO?Kq6+N լ <.nIGޯVv[p_?_ d>+8%Gﯴ*mcn/6]"2j?:rx~>K{zzV؛~GTz?K6 N?L@zȲ?W7?g^?ԏ?Z g{{\z~?~j:Э??}ԓ֍@30{q`S6<}o{ָqۏG׭׽REV=k^H6?GfW=]E9&{OZc^2Oniӈ*s)Լ+*)fҷb؟}ڤ~];i~¾) vz'_YJ8ء3GH#_2SP\Q/, -;gׁ4ZVП2|@F>f/AN05aZ,eFb+$ *ev5oqؚQb|eilJC bͤG4q"|t|DpWaUT?G.h#>bIeIf3;J^0ďf*wlm"E(*Xٺ,Tb⯫x.#rU? Rh[?˯PԮj?/Ϣ<31{T{vz9)6fGY\oSYruS{omd6X2Yͫ5eq4MI0GB&DU0JSEEC aB+W'>1~0nݯY[rhdek+?uuoeh24 Ӥ5&jqu-,>,ٴ[0%fOE.*=W,-zXّڒit!4h(*I'~`QXu2CJ zEv|6to;󛂣au; 25Y&NhapN"j$G5e2G*iйҪ9Q_m6 ->Fv4O=LCI =^pcց.Ȭ֊Qu:E(O:.`TWϗ8ϒ,V>]=CE(kS*Tbg^9vG2r8Jiqk)c`d,5Pf6 T@}@|LjF/K/`Sתfl|6LlTo&Щd2*&*i㎓)|%0dRX{U_QpP%fXX$M-ޢ[K*o`O2<5cdQMJA 0)ˠ ˍVpfOGxR-N'2zq~!YEdR~mLEG}qtYGi8 V:hhD<ލQINFj)oJʢQ$1?:O]ٓ7͉IM`{FmϜyz9&W#GOA4JUTM~fg`^4[x)WNJZ@>>dB|uRyJ"TI5'&7SJ5mՎ->Av6=}h~o8)뷏bMbp%>BlE)t8a7Vwv|tai1ɉ0i#jAR l#Uy"H^b0[ʹ:K-i@8uIJP<:p;m]e+;xd咯 ܵ_FX0ZHc2-*3<:f7šZWXCƚw%SLjw QOQDSwVuxSƀ8~D{kSʠWUH>N}_hǦ>,~:Yln5,u*d,ut"y6έd&ZjdjOM:A,~(i+.#2dӅi_}6jߕ`=Qɿ]8n42k6Af>2|MS*izhxL`9!s&LMsWo 5T32ޙa3˦}Y(cb e i"r1\?_c_TwOl}pmz\~-R*(ZFd xڊ K3#D xǬ}PHhw/+jY# 䱍\$#7'?O|fzH 3?zリPn<]6)(a cfhJ{GZH@09*B~5ѥΏtH!XM q϶&N +|zqp+N܎2"G->Bqh)&FD-5ƣ=򣮭vX#& W:2ƍu՚uYwnnl$je3if2@f +I)J"!ަk*IW6?AaƓv~GʟTUe#SҜriHgQÊhi*A|C,m}\/&DUP4J`ZVq\GN Г@+Ο'a ?NYbRPCGlphZOxd?_izޞj)14tWr!>[A@\ܒc&_OO*uKk%N&km&޹Lo4楰E%*J$;M,t"H56nZ&j3Ok >ʊI :$>r6fn5<08.#<1ףAx5iNo|Vrk%S+V Z!y*&=$ u$zek4>Մ%\k2Las4bJ}E&>!Q!TIIROԊ]E6NKqs Nj+kyc8i Y/&* Dzϼ&>G=(|jѡFroF#QS/(*PSY`>c`;v3KxxsC[,YU)2WJ]ڊ]1;Hic?u#i]R'Y]Co~K+BMt>'Ho:SIh{3 z/q(2aii)#cOI,.n,VC+8ZXoS eA)2P))´E)_NlB6Њu*pn=Q 7Z/h-jZ ңLs] 0C}6k|/ ]<.:Q&@FY~^"y*M*EI*H5;{x(|1AYθ:lْK=,S& q5cKf7`l-ADy#(4WԋlOfRIxtS'p}"08 5tUbL|d)E) j>Q2PPgHY;p YZF&'?~߶!VrQ}*…iCҺ.ޡ٧gt#V)E1RH wf@x7tjy,Q@NgVo0CNPM4eFnm6EޕHeMhrIM?.ZG5b2ƾuе;g%YM"v6nM M" Eų$>(T;E_<$fٱJ=.O5$궍;AOxi!p-i 4?/*fײ+=: ]|? 2g mi;ĚeWjeTd|wʔHIfvgQ 6S|k+UM2͎q!iw6eIԓTgX. ~]#>f]ph]L< ^T_]T40+F6'D (F2{3[S-ꡡI RcptƀYTY$u*V2 qZ'#h0o՜z"ݛ%I]}S4 Q 1DISb=6KNV2Ulѵ8WPCYuu= 85Ǟ<)R~}CՁ%^ҜLɷ߆3XQ$t Sq<1O*(L'+3r}n2 QXZ.ąIX*{]@ \ [y>j zW·]6i$RӢOtuNum jb7}~t9Q=.N5*jj$0 ;8yKYO#cXb{40$kpOout $cgI&NMxV1ռj4) #4.,'+OW SPːZj *Vg~j#Og7$J!qF? tg<8>ΌrXݱP-TrJ}F[ ׇA1*_WU)#gAB aqIC{鿱`"BT5~=%<N"?|RO2)^ڢȈw Q$gtEYOdm%>3tႃyOCڙ%WpBd79`B,$c=O?Lת]gR:XFA28шu/xgz{ikOvE2[OƣpCLbF)%YQyK4wD+z˯Z+RL*#&#Iu3Sv8͖)M-XZ[,/ECyCк;#PYc&įza6_mc'eG$tMl<.ggi%@xk^C7MD?$5N})#+Oc~9:U'׬߁k~?|4k@<\r zI~~ANîӟP&CX/:^'_Oo_t1zTt׽-Ǥqss~a^"땾}?'V46<]1]"%[q͇?`r6oߕ$/by~{lӌV`EPB@sۊpDu^x^P$^A6zy?[{éICſOkǯux~T<۟G&{ſ['QP>O<ovU]q?{c#'H?B~}xu<A׼f,X6oYG#oϢAfb/'<ׯ4[Oj$~?!7?>9apmǿ^:&}/rnZ$??_{.ǮǏo}}H9_{^:}Q}\I?z]&,?Sӭ\?k*lz]\<o{"ӮcsACzupH|okر<]_ߏz={ߏ*OG<߀wP^ P8}o{=hcW3XZĒ?^X_.N=@_ǿ֫׽7.o^\#>O~U^Z b./~-cﳯ{6/ǭׯ{seԟ87Oֵh uݽ ݕӞx?}gu׿rl.xs?]k]' cu׾&݆z=ƪGlH=m8?ּooiꆽEnuǛq#{Mђ'Ssn8q>4kۍr?A]~_=r"=K_:۴V5/Oc†e=F|SxMqmZ,$ c߶<0Q%M$̺JQdת'{sB0g6plGo~'<^%\\۟u":^>.Ssaoivzy#, ֵ>?mq~Muo &Vq ZK__H7[o:O'ze|nT~{؛VWWA}Eֺp${ ϯuFdI s~IiJx_ ܑl.x\ɧ?uA97=o={wpJ_nu9)׽R(nAm?C-o~:ـ?둧s?_$):sszu׽:qOo=PwO<ƾƃ=z:a\POo͉ӒluUfOW:\/ssr]\xjpU)?_?}@-Ů?Sg?/~޸O=rMm__Gﯻ޼_gӃM Hr#Dxq I.*n e?蠞[=w~~)Z^|܀k{nAyu|@{ߞx}Ҝz֚k?μ^&IKKڊm'k^8[y`S{7 ݐ_/:GkNەhU>@O{"x`>by}ޫN=hU_|#M>:?$[ߙy,ܖOlשc7ǀoomO[u}ͽ%?~Z톯p7]OWak}G&?>3ï^~X؅,/l޿\z\GБp>wWh7ӟW$y}?,^Ǫ}y?xW`}lH_?[|k-/UkC^?{ og*<>8sk^׸'n)}z}q< }ϫ_׻RUz(k^\~"x+o1VV9?__n0Gx~~8 WXA;`ߒE7uU?Q}Xĝ'ǿt,Wb-k[}/ߘSCSſ?kXŇxuJy=ſȰ?Oכo~zz bq#[Ϗ^@YXlG?=^\g#*lMؐUjkuz+{ t_=8P:z, } ?1~}q7qW{HT=QF:ϿFqG{m[#]ykEW?}INkZ m7y[gx'~kUb<:G˪W?O{娪p,Hr9UV:?_~! ][PVo2=luC6P7/gypcBױab @6`?=2oT"oY,E?ԟy>ͣ=xc75[jbEq:>l.o(6-;MO=uk 짪x?~xt8Zzמ,/ :ON?ӏjSZnH~Hj7&ǽ0t7o0xsk?^{o[ߓ{{Oq[0~<g9T}G?>>~-^^y\_ޫQ֫^roqoiuyc?@s#ޫ^L@25[cx{ϟV^ܟkݶB%{?<~~`:0L9m"<)m>(mN-~\_8ǰ~]aGgv;m޿?k_dUڹɔ>J/Ӄ$,Em\k)8A<"5=kjK( [WB[.=$gRcg(4oƠ.?˟QÏ]NFJ߹,W`[QH _KH䋟s4$! f:'_mL֤/~ޜ9uʖrE咘eWrS4g`=D-cp#s{t!|\q굧z"¨ e9 k{JJŏc8<,[]+~G7=$ \- ekX5سؓȹ[թ>=?@/c`KOIbbHQk~ztܝ,G38.E_m;wr1^ɷ5FH5=O==/*Mw̴*Zߪ?>U|Ȧ+`[אF>_ۯۣ|5:~}}'=^;"=o{חZ C^Z7#MR={F$_`cZx1 uڋ:@n^ȷc )-)(c_νwsR?g%W~.ۀ1_!N,/]1%rtH+q@mXCo{ޏlf`M쯄!`۟>>|6#ڇ<=3guSS!AP 4{?hHuy ּ2cʁxՉ+S6eZ)R*>=њGZVWνU:F`"MSq~CP`@T]*΁I?A~>>s\q{d"|;TԈLi%,bO{\aVAlA}^\pov+j=#Pw =}@#/}A>_ v=/7>Ғ$mK}'x@\xHjI:~z8C^ ?דaae?vxbkӈz܃=Ĝ%_C}} Ҝz>ݮCCR vz|AƛN>{O\~}!'^bE矯~Mνaʼnu՚~||ˍku|5qO8O2 G<{)jMi~96?zw^[c@V:jz_A>]\t{nl_zzҍG={ߟp [߅z#{Xޗm}}:4JC%['ǷB(:W: =dq Lj%.6$d=QpOF!EOۓ}+Lt_lb%qT xczmS߃"y{x3@ W-PqϡJ"@X8|h/uW0SŶ& 3yOKK$=mM-N^ (`Q\tww2칷]=)*(*afY0"Ƥ`d@4'8D)+g45~|3^4D`|d=O"sp]Yfs ]SaJ=Rt%cz|]njx(2s;奈L1b!5@GQKQ=;2ƂHGRB*=(~Ӧpp!] Wӣ%Rmkl- y65qEN1cj#%t1 "1/q:9۾Y>*[p`'R!y+nH+$tLI]ay 7URkL(#ʞ\~NXc_}xt^qav^Ugvaދ-Uy~W`8C]jeSM^LtSjfvgNݗIlj| +ζ''gWi)8*Z:J:hi\_םH?W>};(16gno5=`k㬢H_tyCSo/su4y i6fc!x/pMBPvIJi$ՔT4 Ny.T$ 1I+V$s U'}CPwl}^龎{K6k˘os4FUcIy55{S`l2jeJC,U3%4,c Ė--%I P~)LGROߘ{߻XaN5XKOHQ2WGq%qƩO6fk\vEC(cq [Ksr}B;={PƠT׉j=>^TDHCZxR1wfjN3'qnך܇qdpVKYWIS:@DF"Dc6>sWUӭME-:VҊ;֠ZW8,IOO/NM.{6*2.ԕp͵Rq(geC5-$L"xM!Qtd},6B~C?mFePo<.䂏:K[C%;1ed*RZvhh Q`Ⱦn;\dw%$y)ecU&(B$b碌)iٙbGiJ֠滋JUC*Hǩn94ԭҾrD}I[=.tI?WjhX=}jRr4ʊѫ4d_i$EEaUuU;WR⢖wfHZTƎZ4KUepkB>]dm75VP- |τ+zkGw#HKT||"(TPI|d4S j >/fdɴ3tx|ŋzژy*(9(o,2SHZio #DXhn H8Qãɯ@ $&pSViz˯owCpτعnsnfs_q-_9Hu:jFZJj^/+IȪI,[3Euҭ5E,cw-%Lmñ !皃f3st]A  zjݯ`%%55=jL?3K:UGb;QCoC&puB)xg'`#Hd 4#|z܍4<?Zvevg7>ٯ⺣*-ٻ]?Q!H+i⚢ZhȭDSG%<9#eUv>crҘCۙ&]L.U_[6F4OL Xޘ%qqW5͒ĴX$hehJHJJ}d1 B²˷+,W"u%| :e"K"5\sun06k1;x .5[;Goˤۙ7j QWC[$[l2)+xR\_faIcW %Ћ?6<[́JN?a֚UEQ/="Y,jJXk>r7riYFdDk_H$ShHɯjs髗x>:mBnIc, ,CV$&)]eonHnM]=%.'CXY#m`1*yU&?ζHĦI|Ȧ`ԑn])Z~aŕ9"Dn/֨D"F Ulp骚0q7Y*HaDD ~Hn.zHmM^5YE<*."MDF.CitɢHu)8f c>J jjxPq9"Oi?X}UQ$RV҂j2pA'K7041'俎8="3{I_rA|C+)Us`@j<xjo]2MO2!marYhVF"uYFFao_ԅ#W}aB+&)X>fm(Ũ5:#!V-C%A_c)XX!cgI'M y}#8$bǠ=#OWl۸ʬ%4Z8X؍@=H>)%I%sza(bڀso${f|'8pzW󌌊R>Ζ[zA_TQKG5&xcRuHU? G$TqL^YNdU#-H[}5%yԦ`IHR̊yP $4ү-ۘ C,y#Ǿ"J7iS=Xx4Y]qzt0☲1N N~m=U4H= u鷯)鎜6;=6f(ТS)굵,H%$HQsb5uB9aƭ"bD@F;i1 Ik2wǒ΢|QҽLjjiS^9Քusi썷OpMgsm#4N$JlfXYkfUy!$"0Y³C.<]\o+,A0W"[UEuZyS:m X y]Rd1KP(lM.?~ uQCK̨1F-,K 1TMP r@(Ra8-x҄~~)Y@<8A'UtLFPAa6Ԑ@Tӗ !hn$QM$KYC664+cIaq`RHn ԩo{TRn3Kc#NozYa)p{WӨʬ$5Ib8YEf6Ш*]vjI壟±@_S:Bffк밬@n)Jʝ) mz5i0zgnn #;MKe#*hL*& Cv2ImLZ9`س6)RSWQjE1+Ajn.A d~Uk3n<@P$=#>= !zCU)UYLsmo$ZˤuŅ-4 3(^4qQV }DU$|\.䔳X}4nq-p(ZAJ?>03F q$BG_T6n̻/lƆqwv%R*LI`u BUE=W۽~2# er6lyC~I_?_uuӎǨOZ5ԁl:4%z}m}^OsߺG}Go{_?Aq#o{4?{}?km^/)ǯu_Mz]\s_ǯ[z~ [/ԟv>[| 7 k^￧:~$iÛ>^~x@??{^]7ȁ$~?m+}{]{{{u>R :o6S׽nT sߺ3׭ܓrߟ}ۯu׿zI`$(Sm|8o}DX,?؟z8u׮m?ש׿?`)7}]X u׾7[O>ǏUH6KK}^^|5?OqjZw7}=Z>#$/a}7 рN Xq2non=qNp=w~?ۦ^bϘ4npO{' hUGS?KluI_Y`A7@SWמ\}qZT:l#ީSוqJ{tXuv GÏ<g$LЂaoGP>]Uv}N:܃.s,S!EXXU?{Zd؁ӇT:ve7Q{}9_z:G06~^E]*^,W,Z-V?i}fcLrŋr}_o="m'X8JGgF71áY4雎8}O7}?^&x~x'-p.Fyx[huTO? ?o[]osa#qֺL}$MSa݋S֏^oh̅:A܋FoSӀ-ŀ?1`-{?Nmn?uw㛯3׽_s :EzHT$$ r.:^ď?{T`}ܒ=7#ǷbS^'{,FT_{p\s׫NÕ:zΞ}z{bE<-?O, E:@nmomϽ@4Wtybc궰r>׿P /^׹ϼW ߟ~? ~}hŇ_~ko{fǯ~=y% j?\y~9>_{qT1n8#??۽xu}͹6҃u~Z.yG(:-8'o_ u7~O^,?W ~}#\zϯ{7$~oG׽<3u߼_kc6ӭ~}uf%(s?պ߀#9/qMsQcckc?UϾ\}J?ipcw`,,mb-Ot~yC?CTz+pOЍC=WWZߦ[<ޏo{Wkqo4pe_.pNL}|=辯4}\8,"OZ"Pa{ kM~"̹"X}o{˯u'oy\K{Qt;\XZQo|ء믯+ y6oU׾!~ ȐEd,O^<~/ǻOu)Hs{R-kN}Ҁ:~ߟ}OW^r}k(%t Oo>¿u?R p9|^7=@^Ab9ԧO Y[sur>7qnmn qxqzZ{t} @{x>Oy돾@ ki?omXv}oj.H ݭU??~޹"(wFU(!%d$n9<kk"sIܞ9R-Τ)3zz=qvv*!{H,跠s+rn sySVJH'R?D!%tMy:S,M#X~lm*Ào9^Mq<7F$%J#Q{7#[*>_{̤}=EHJıV/6$YH!?@!t[Rj**~z|c+HO?`Ҥ(C\ ӹ[HB3I:M6xs3#YTH?8݋"."zs#6w]VlI*o`{-O~YC\ϭ;S[ 9Uή?_ۿm=!{EM￯> '?K%ž!=VU2 *J},߁oVj[kN8Ս|6ڑIҀIͮd O?/Ϥz_Rp.a5[gɸG?7aٸ @`?ӳ[~Zl?:bL"X>Y%},t{J3iÆZBjOzWӤtP9!Q??n>S)X{!Okٍ7чA=ez:+~{\z'={<_NzNG`}ӯ{O#hg{׽,X}OzG^صŀ7?8*Tc^ѯr~?\aEzcOGQ$m:4lEMǧg_ϧ\~}ErS}m@?OQ=w%ZԿv<=$&'8ϸqHu!rizKoXS=r=z;bX2E m&VʧP [ȯn:ҿ?L7ouldeG*UC^TXy$>yBɏL7+pmq`-7ab#JVΔWV :ϪjnO%q,0}EŎH@O+bbђKR`Enl8?o)NG1t3۰\}mQ&;$ƯImlQk-rm^SvF́72]ϐi=t tE /Y- 8}n$@k:31c4փqmr>~Rqg׽s^b<{:d^~=`zUx~n=C :Ἶ?_aF# h\N|G#v9~oh+{o+{N03_oH+Lw3mrG=qWUv}g^qq{'oZfsc{A?{?N7#p?O=jo˯{5^_L Ν{JC-aO:FO,ux$:Hr}yin{$,ܐmޏ=4qkA6z֎:%^oͿ~:(?Վ<z>ָuxy&p?c݉}:pp{?tc^&{O_m޼C-ig;O J1Caso8A=/5s|~]]E0p g"XXē:5jȤM8 M٦lg⯤0%,NRRPdL3{ -B'ˉ\kHS@kL3?*&8Nes 1*tgv^+ܥjj0C4UG8jGF?7Vw|lM}Un۹ßYTK:㦃**;M,d3*`4jh*xd?J tɇj:PH8:/[Թ̯RvƧ`b+6o0$%]|TxGI4Uq@jiݨhXZwf)SQE_["Wu* ȧe)ׁ՞J34kֻ$25۩}jM׹CHWJiV(W,TUUK#Ҭt=g7&?$Js-f!jV`mDƢUZe$ǽ*k hp(=~~]ܺ χn&ը؛f-7}vԙxXw\Qam"GB1ʪK],Ƌ U!i&iN_T$6>Db,CGzt Sxp^5R(<:DTuvU;g-5~3xl)9 7e!Ƥ^Lb*iw- ȱMS&pUiQ+F^i8PN~t4G|: Zk_MsA7Ѥxl;{ra1;7~.IL^ݨb )\UTcTBY\SSvm+A4}"ޠ$$T̈LfUE P1MNr)O^?oK.SP+ۦzJU:~ pNpSe;z`1Cu. 9\VSdZzt YH rC}E^;xPEn+-`2ɋCWȓ.>PNr&DeBb4"ETZ i=Sx,r.1PѸ$8?/lWt?=szGs=6F잿4Foo}^rwDGՋF*h.kKW~ZڤI&EPD]%ai;Kh ~!-RiGlɨ}^/AxBgdZ ƚ sk=*39ʌ]LcۭihjiJyETPh$$W $R:FMj!֣%KRT&Y G'ajP;ozjLg-Cm-KO FL^gY䩧x^ZZzy3Ȗ[nn::JTXaipr*!1JPeQ$S#F ^$>ډYǐ$>uzZኩ$3bE(hN3ăף5+; 7Vklaif2+*zjM|ZSa?!:觯:XbI^D/Qd@;eW7I52P6H8yxFQ\PWGE nȫɻ'!dm-+m.'%CKP3>.UGTg>: 1[lja8钭Yi9*;i6GU؆C#_LA~62=tϨ ҟ>;w=(vB)]ձUͥ>4Eldq3x&ȃDK.U䡒H'ZZl e n-TwhV Oٚ 4qqWH8bޙetV 9h+$`)}JZ)<DH Uȫ•.TJuM$ k_]ͫڀ̽ ÅFH<ǗFHq8?`TPQ>6S'2D!5!I+rQdWŘ\Nm4Z~4tf?RG*+S\3QZ=)8ƫ-]%?\sz}`Yč 2X?4qhSKź-$Q9>PTz%_PVNyuaH@e>MA|qW]$<Aܨ9&)$PYBKi25o#$oG=5VadUD #H_~o:ƚ\TtZHH>xCI[<4bdZ|z<ȯWgeP O^1襮Z :6~Iҷ]ZRAN)㜏˭Ib 4>GtۯsUbKOU"YG7*b $DZԺ 4upEѧ(+ݟ*q5?oxyI`9i+c1fV$ gZr"bKa!ʉk~&nSKX=G 0Q 3M=1֪5RZ, +;xbTb5/>=JT'?Caj}3D=kel7怭IrNfh34sUͅog38Px~|Q#jHt0)撛E65MT!# cҠj>Daj15&HH[Sߋ}553JԾq)_3.6Z/.ZG,^Zk#꠪ 84I˫R5|ϗS3Ysku{dࢫ#7cuOXqIF(e-)DQ #)b}\5+YJj+ u7~}]\FJNh~t"C*E2F3oh/tyo3RnDG!7"D=g%eU,oxb cl}'ҵF8垖)U8 ycTAO%e2W׵H"dyOHu$'Ab8̕1+30*2"ޫ9>yG},_|NH?ë$2a`\V{qC6g*Ҭf T B)VѮ.]}⧎PyEAC|rk[] H%m/f "O5njNrgB6>kؕuTo*+prꇐ2UJMB n"JlpUEAP#U^y`+ʼ+1?ݯz [uax*e!ָjhñ*pZ5L[hx%ZCiϐҢ{ Y"p}*d^M8'֝ V,h jp8?>luߥozퟕ$8ёtLrqf\͋yeoZDldPng5Z/2)xgTkXHJ uqϴJ'φz- I0*kq}>ޅ\GOtylZ>hsJ$ #y]gU3̡-*ƶ7鍪*2h&[N_ UYny=2UϯV}:#'N$Epaq=iX"2Җ%+N)F4y䁗K;}:+旴~vN1A{g;+Fs)>:xL׆ZQf)! j ȷH7Vaϫqc" ~?>Ou>ucĞ@b_}>^]{l7$ےG˪@g{_}MaN)^=V=s{<{2܂T~ OQ.@ \p?#{PVě^[b{9ӪH(z{ۏ*E^wo|ZsQAo{,I&_=u,>߁<W?}ol8?r,H}y?|=Ssſ^6'ԿO~GZܟz\:A C~K=luѱ[./y#u7}m[ ??F|MOKx߉7[í^&G~T??_#:=us`ߛ}Gا^O$sV{߉ sm5ǿ\ؕc>q׾.~=hu.K-<ߒm_GVs׽ר~><?߸uu?c<k^zFnn6u!>I??{ C׮=h4_8>FhG֗㛏HQQNĂǛ7KNR[?d^5m"*7Rx&o]ňR}#"P|j>M&Zz9dMN/:bZ^{hWNp8?{k;"koeF"\rIK\}>jYL.^%`o^Ʃh|f2Y8}>˯{fa/v~I{F4KW{2 ,HOԕM6 ǚ:7OX<~-]Tq^,G$3}?<ןNLun_N ď{ހz5^'ߋ%r:Ol=E@}: h~:X7?N?~?}}.ou%HWZ}znzZr6spZ:~}t@7}Ԡ}nm9z WȷLH ~_C^sO}8XX7G f]ۛv5(z/]~>-ok\16=~}\K??} A$X_o{_㮬p-lu~DXBH>,t֜z=pZq-#H$slu~X_→A<~o'ݵS^=q㏨s}Dl'X?ꁿ<[}sָuO}%*@pۏ~Cz_|#^ٖQ'[߁^^߿n45Ã{{r@z]o? A!'  ~?ÏvV\:[}-w:k]^ j|z}wo6I7&FfU%?}?m[H6E xӯlHPކ7P{^=u{I?A7_{~^žAo~>=uo<{Q\[u^}~aq#X}7y W7{ c6{z=q?O.?6O~:]O?]Ûk+׺yԆ\mDu) r@}~{[#{^~q?O}uu};]PũofR@rxk]&|_`nlt?_~_ Rڙ:Syfs#>OAã%mywqcwsJ N #{τ,"s{+LdY_ˢ3Ϫ(R6)G1iKߏ6 Y l2/ 9fpʇz+~QF_0w# IZ  p#!్FHΥ,O}P(xh(<$QR JCR~@ Z<xcb@6XnO?K҆Y~\?:4cZEFXzj6uVUk0.=V{r4I~yR(|\|=7=Dk ]*\7(E~:n :+~w4_/?:Mk C+O:d R $-?{XJ/,Ǐ_ ,9}v'ъuVB+^50YT}@z}?~8{h-I4?˦{"=2+9-v`I:(qRp s{Ո7nGƸfS~!{fjI&enA-Ӹ? 8?P<ntS\ux%:?{ꇯ{o#:?_vU^[l>{uWO׭^IX+ïS{ :CI7OϴJqer(N3ҀƠyW=t@cJ;)Hn?6_?a3GOL]T2$~qχCBpL1nuշ#~=j?o3&Z ?"!Ge\惏L(ta긩7**oK2 HPFAo$xs"7Spxߋ058jTg1ϠZοR/ȭ Ikٙ.Y5׸5^P:H[/#ZtxNl-jQLй>= _E6bJfHXqE>+G O!XzM>+6bLf}'?@pOG{H{Z'oſ5WLNTdpǁ_z㞫ZݿcXs=pOl6> ylHq? _~Β;j}OSW?.ryaZza~H[<H$8>^y^}w~u}]sfW?tĠ#uxX--oyW^ cߛEGc"ZG$ۋm6j?uBἏ+׽v-66}=GWvnn8Y`?XMTO]SN-]Zѽ5,N 2|.YM/jjbO UVO"$ښ~o$\c.{'׻%bje1m0E+lu4+r2oJ|^  R^heon##_ vNwMnsKHU}zݩL^zu%CGXK=oprs~;PeEnKcjtSP'e6)fmCJQZSӉ ﻕo֔ ψz/;}O[vwgoٙYtm5hj$|E6}0II8x;"k堏 Ii_p/:YGՆ @U>y%r #kO>w2.{!>J|fB)&fzh*c,:@=pNqPRQ=ltYH)gz=bV Yqh ‹墕6<~Hjђ 5+'W$y)O͙W{-L(~UE_ sIek,d2ʼ|ڎZw& =MxtßI IK1yi!@D}@ofM)MF@$8EhhЯ99 MN:öz/ܧ^1b>:o%)b LUu=.Z8ZZ\G2OOZhg˥$RPI|u^kM.ĝvhY/}]ݬ|֨ZF)QP4?u$]hF<3W_Ec* ?gnZsQAd&H%5w$PF`]YP%nܞjSGT Y!V5\/Fqp* q+LJI٢@Y m:)CC5>x-ô*i~ңDJ|̭*G2G! VaV}mDrZa%#4 *"{~y (, )O3ի*GOѫ}ayeVnk6:8ީiեtb6q1SۘZ]d|t4K-FyIҡQ?)jrIZz0|B Ԭ~}WM]:\v;ymxL}QxsOKM# 4 mYЇl}fbJLd L n#(mc8W>F OT0 T 8)zBU3eV&jUeRC)FV&#)I* #$EEޛA673F +LqN3tu\H'^^T-FB)jx('ϥWrXY{;-Sc)h5:cup4mCI5 c.v.C0 u*4PYqO$G!K+1xIPkXHӤ7 cרGe(bA l-@]YN>7GgPZPp=<.EcZׁ΃!&"Y Uy/Z&kxdFl%GM\9eݖ&x^e os>Álzָ=jᄈ? y!cC@ΐE'2aBHMX)FEFK2!8f6N(h|)J>_oHsM( z>*YQHU3A2='YJZ}V -bMspmY1Q8?!ztIM*:2͏ɤF]LQ+IP$2G,oMBgE-֥W V׍H59&2xNNtUcUTe&a5#Ry-c%A[嘞}Nظ,|q"_>ߟհ@C/$@hĒptWϺqqqÇMMkR)lfWv妥y񗩌Q(XҪɬ9S#,+dYqAW1h]c>ě5G6'"O!$U vdU .ޕ+,X åYȿmK֣*G[%?oX5G{t~&־P1S5TwML4Ed7EIxxsp@ڲ:K3 TEO$\~DT:kdTgʂ~ji$9/MZZlɐ<ZoPK,R啑4R X$Ou0OAJXk(D#ďZxfc( B]K1Vmց*'zZzu mpxeܰo <}|kpK)+UrZM8BܫӪ+ ѩo܅DId z\ϧYsղ*`%_Ჸ!'d?6,Al j"<1^-%?MջwG_8ZuahTfzkpGl;O-$,`hr,쨣$-]J`18=&n 浡} ͝S. ؊z)޲GON5 TKbt}̕+?qjKkbX9RH:AbIj$Vq@Mg-J=OΙxF&B=2¨BxYEŸEKE=lGDբ xX]%͈$ {+`g?ܴ,M}(1SoМp죬++T5Q~*ĝ'0F5dJ%rqh;ˠpU@ I<PDZ yq*-htQ<.c-cTN(W.M4奍lRȴK* I >S4J-H8sǤ{&?`Agt]26c-%LMKimHPʋeKt(LTJcB 6(o~"^5RPS~\8#PZM;H$Z$ԟfJ:Z^x%*a3jb쥾^/k[ump@<0=NSRGO>Z} KZf[(8e]R5oϧP_xpY5沒OO@5)*9*49/ASKz6M|Ki_N= [mM>Z*\njf(jiZI#RU,q_FQ$, yMJ=?I-4I:T:ϤVËc1.:L2Jd᪞HxPc} ]p}X`-F!/}VPI`-{ I>J^=~iլc 5+dUH)|ʧ ~lIx. 9cW$~tKZ6l$ZtA0+Mk3RӂMۏa5t9 ujI5h+Vf-}Ipy-o&%hp_>)8`i+'#OQE==F:ffJ"Cr@T_뱑c2P]D$kP(@RA˩ p~-Rp+z:TE51N?ԭ;RxlWhSK.faeqy)N:$)4*JdK m!M-JMH$TQP6A2C2}zrMJ!% A,&ʡ/H?XA7U(?:5(1t3/<؏> {O^< xe]@ <u^Y#}?h+\"#I/ÎMV\񿧼:UvU,Gӯ{P1Q*që/}m{o=kZ_lӯWӮ~}z]~=+rܰ\:΢MēnInGтW^S^#oC)d1?^-bЏ$~L<_j%"i#z\:A#s|=~HԞ=W__AqosϿuS!ۖuZr9ȿ{P:'G[uk}=pĀ/=n׿'[~A)xuǎy[|>V|I_ޫ֫`_}̀766?:ءW?OUH^uW}?C?꽿ß~xzu\{[^~{_+io~@WH_8{}9\?Oӛǯr=MGq{ˮ?<  H7t?OxT$hI좤&TT6~}Ku;$^KDk{n ǏQ+YG}J/Gz* Iw-!{`uyz;K#WHP4v?C׽$@DtcpE# S{W)c![eM_hulu,GV`b9_{gWIe58N FUؐA[[ޫ֫umH%l4STSNЅb_Ӓ}OC Me_X?v+3׽D,8?/>~- SGx{aONUP chur K__I.#o`t_P/q؛aÓ s7x_}_D:N~ q|z }'}T#ߘ{~?ԐC[ߟuU<:]{d77 =hdu2 /k[{ ׮@/!c)bOs/M?p[ q3.}nOA ޛ~dg)ոq?ZHp.^,~?qe$@#ӯ{"$>ӭS_.$M?EV@WOóE|uu|xtxׇ]{kpl?o{Iϯ^W}G$o\=6_lT=z{ߴH} @z7f+rXV'o#6u177`Hֺ S^OO 58g{o<׵׽9 RߏcC ڎmEz˭ҽ{w&??#`y+׽I6^^~hx={|oGҼz h}k(,,tߑa?==xq?^~IͿ_V$n={ߔ?zT^ͧTac_=`:,,nT}{x:Xs mnt}qb,?OWMGփW}?}j-]YM}?ߺW}@$ۑJ:V֣չ#ߞ=:ש_~|z&7ޯ)u_MoHU6s`y_cz x$-kܝ@u={F o"*,ϯ{CߎA:i f}qȿ{枞y<߸`:yɿϼpH~otfZ+`A W<x6-{>_.q?6e_|^1b97a /hG.J?6'&ַo{iֱ3@[>6}?}n&fBAܞ-{i?=h6[ߛm<1 ~.+CCB?>ϧy +LJS}ur})}/lSSg~?[Ck^/Ow'Wq>qn>'E[#Mۓ]umV^X YІ^G@&-G7V"K{Z=o7=]J,F???> ?ϯ6Hr^TzKSu߿p56׹&p߫Q8RڬoHy<8uJ( -no䏯"YCss7zu%X^~m{:o\W&c?uu>]c<^};YoY SMWK"I'{t?7~Z,Lb 6-6{gA_ ,M q:2M? X`H{=m2k%P X݇_k}FƴWmoG*6R٣ r*:\TvԀIm=TJ ~TGu7Y IupN?P 0Iuc]6?yy[#]_?Q ^6W} A$er mmH7o;'t"ҧo^#?.HVבWBcξ ,I^ptj}'E_HRiZi^>.ytfJ ?ܻydNq{[ܨB1?"iω=0VUzg$ i %Y~B=AH6:X\_l/bl?8:Ov^Idh) ȧU%l@ ,ܟer C ?݆5_8W~]0IP5:u!I]Ė7x<3̥ O9qx_/znMd4ϟMtzWf^CQYl$=\ߋ :oq&@}WqUd@SH>˭@:ujg c?Ckovo(.hʹ>ޚgJ~gkI /O$fKy-Q :{C~JӧX'OSU-b=ȦϧTT*$!k=^pʚ OOt'b--(1B^s:/J&ZoJvSLMGY,$эq+b6[9ޙ~Y6KKqo]5kVW\ZH5aTʖ50QL/E+OvͭCYCN~޵nmͿRhvOxjzNdpap@fgc1:X㲕wh1UꌔҶ;)E%[տR#jn8oC=}|\^܎: jpnT?No6GBQ0,ղU,U=Oԉa(0d:*,jVf$2HdC3c,p?#y|]6NW'ov6`i>شt&ӡz8jyob==5}M"TLf{cmyF}\UTR`j,WY vX:]T6RZLSE>/Qڝ۽;?do-j,ŵv9cQ%N#oǎJzT4gG6Z82[i'.)Z?T*UA\4g!&7E0H;rlVmnq8c$y߻Xڻ'Hr4R*$b RPk(j}QW6֨l73X5~u?gkV=?`g\V;pE<9WM#%=II,SLȪ/*+T =>5Ȯ\:Y|b?_oLFMkZPq^x =M8te$G_޼VS*G I Y*IOPXHyV~կU"o @M~>]jnI=͓+]Zyd#MjĩO NXRl7sK GQKKU T#Uy(r4 L3't@]51B(|}pHcsRGA]ronvJQ>~lBf65l}z#MKv*1Ւ<~>zecjl=Da 9۲UW[Y:Q:Lh,Sn2j@ >뻯ІҠ=]?f`;'q[scmXmWBFc''3ԘڮO>CXUaj6.4͏YI3*ON_3,(I. "^ef="T+^ܽʫ>Rk[;fl~87Vtu~Сۙ]A%MvIv%;mJZdh UȞS0+6=Y#T±{PO:Hp82̭+0~?C iz F6>II[$͕SS`i1KқHRg,ym\6*/GQ#*Fa 1SnNԎy5۷RZ!5&?_!]ܯ$,\ʟr͵Gdr5uheFHÀ*%҂ 43M=ULQD@ln,4jE ޗwUk-6Z\`yCsЉO+|sIfmUqA Yڃ.'KL| t|TG r?ǠcgVGq_2˕|PTU%c@|1zen-bTOWS2ҩa񵙃1& Y($փ֯CjGHh}]]udzB~t|U&5xmܘ9#K]cS5V&P,u(ytʫarA1RB ]-* MO?Z<)х߄W?>-~>%YYXӴB ,H߾U+20e[QjYMO99DYgbmgx!-W#SH~G >"Q_zIuϒfhgEtV_\uy=I_j&0TSȝ(6*YCs)7ZEZy3zi zqWmǤYpjgyc5Wn5)55` ƝJT/e#So·_S_!Zч?:4-cВJ Yc"A_T-z(+iꜹ@Xl IXy HIz:*3zlLTPU \I> N A6IfE CIc9OuH"$rOM[F?鉤<6EmenI:⚱*Q( #"1Vr@.D:1Uh*=S\`?"6jw,^?*AJpG&GyA$5K2MZgꎑcyQrOK,U2hKӢX>4IOlIqWʧ41¢Ҁ&Y>c(WvAM-Ts-2T+UMMPFuZZcIW yWA7`{~-s ՊPqkpr3}Vչ됆 %_WU-)WKY@Q]ܽ09x"ѐ<}y^>8lA?դeZ+b(>n\lHh]j;}"dcY>1݅~/3@Q#p$FE,lDzۡE|y:I/x}aGIQQM)Y(֣-ЎDSC,MRe&H9)/Z wkM^~ooj -婽>$Uzƹ/}{jbH+vA3; >\i)675Ib̡#ƴ)%ЩjhPP+p.XN!%Jkdw^Qk3ʬEC#|>CǙS?(B$k>]HlL^VH'c S (X6.Qȕ@GYDR/kG~uSU,pCQL@xϡ_y>8$Ԥ枳Ԓ*b|?TP,!Y(iuIPɬB@,L t*~,ƢG O?N$cˍz|'BƼ1A!>ٝ9lVf&HrRWfqIOYBĈA]2-( Z&u2o #RoDz;N@I3<;XK F}?5e1Mr"FE*q{ s%GQWU%75<}$%>Y7з{c#KTUQLk l", I%I^ߩO%s.tU4PQ;d@XN9/zb 㤀sR?ԗ)iw1BEEI1޲\NKp75Zlr<)ԝI43/U`ـڲ/tuZay`?th$6P$I|LeEG Vf$j}M"Se!I'hY>Cn\A# 58аBb.nlEgdrA*8$yzt_ 0PiăǬɜRcQ:WArJJuԐ4 8j6HD,c’u A@P ⒠O,wSkÎ):+ˇWtֽҡ%#S40!f`iRVTTb8xDI\B퇨Გ 54,r}4ѹl[$"wztҤL7\^pxi<|JRKU!S6_gXXey,Uj5>zj)"OJ̀2Kew㥠콬5X '娤S5@%SfSũUeqϋ怪ʰʵ!YBTc.1Z/^R^,SsǫDKc$G%mOځ"c7G HͿ{p845N:tܒobly?u|z(fcGMP* qתG\' MV,50df㟧 n_cq?7\4cOϷB=Q(:x@i _6} p׾.=IS> u^&W?_omH~^c^?sSj&Sxpi=r6r?10mJ/{~=pzsmϾsO=c{Qb ۏ'izʼqϷSREԑa궯Qi۞ONO>?  ~ߺ\HKc }-o7&{w8[-GJ)׈][yk?_vtnx#oq`Wuw/Ǐz~9?>YZ~oz׺q|Ԫx_3׸uս7qm$_E}xu{ksp??[x=[J׿Vl8|k}_~#Ͽuo}W$^ňN-oNSZGFո/MA׺_z=?M'Ӥ-pu׈Xx!.}h~t{E68scC'"[sS}J{퇸9&%e@H#N??!u7eZ7k; sVq׽sxȒerB ?#qNZIE8sOQۻ{i?#{**mlMnT??^$U:SpŴzYyæ^Bj(oz:E>א s?>"pzWh&?9ӎ?#q I`)a7m:n]m{}#>?xI?f8Z"6$[>=z-q?!I _Os\]_ep>FpsBPq H刹*1N뗾[i+?⺸w@pl.9~Z}} >Aur.CzI/?K}DT{qp>~{Xs{\?=us}()c`AoW{׽[],/\=:{0ڿWnyo*]~<552~^hpg|O 5͍_??^G7n +kG#T^_x?pyk^pGͮ s=uR:r[{5Q^輸xE6?=T ׽'?߫m׹7j[B8_l|?H{>_ӯ{㩭bl-~8"׽#XZTէ^H$ٿ_1^s׽,?tpGw }{c^$3׸^?Cbz'?4ꮺ,~~ͽ~]l|^lG~ooSR{-k*=I˪ֽ{{Aoos֊׽r@^OGmz^7N_lAT׏^:Y#IP+Չ^G#ſHxpA?B$zEn)>^Ѱ[c?7')54Y<Nm~=C_{hׯ{AnIߋ~?xq8}d^Y?{۵EsOթ׭~?/MHpCm>۫7垽^. zT_/i=kv9A?1[Q>UuĨϾ$ϧGi#M)|?ێA׿O7@G^^wb.x-Ay{':\l?7|JHoS4?aÇ_\E#{* Xy>zzo0~Vcu: ykƽb.@.o>]hsv$>ɜX)??>:=wo?߃ܒEO^oq'Mh}RtyyTOӮ$OuuמÛ}Gԝ@_Ͽu {[7`2j<߀9ֺd,u_IXs~?~_1$x+b8Nue}=QR2G.>-ƺ4mzM8Qx=۵N]ƻB}:^8G3]?mTEB"8#%Ź"zH؋skgcX.T 8Vkӏ?yע`}8DM ma \ȵ$^@"D3% 5k,j:<_c:IYVBNRڬJ ]ƠG kfR0PA N}*k@=)JSW\BNDH,9i|l ZؐBJbO7hSOׁ>b7垶[ΣC$IOK˪u0 B@st#rA"_@v f<+uzUB"c[9<9๰BXTV oP'O{bjsM["t田?HRIΞlI+c% sawp3Og+jèo:)#!եխalnrUpG/m׷40?Z,1h:6-_x(kXV: {#\G_ݴK[ǝBWqS[,>~Y`V2`J \1S$^X{>v|- ~my߲6g|}H*je:ÓzboQeMPM3Wۑ<[Z_<7Ө9b%to[#yULn?K}ySkJp˨؏_t8,CW_ac`If_pZ?~ƾ]4p:ZRRo Zr>ٲ)?kzclnx}tܝ:EӟJ0^S?9G_zLFIS@-h5{c{qoE*o~ ^r=8ya3ԸIC7lZ?[| D`u-[M?}賯{*!؆&_Ue^-ɿW}zhʬ)Aւ~?"H)׈+׽Yk߂u׽QX#R5|zuv,>s/>lGnՎN<o~?Od۵ ,=+3^~/n{Kڭ)HO y~??BoK'UJ@؏@.{rpD 0#}$Hi(}cq&6?jHzGJqV7ӏ?äV8?_Z_z^?J6sDž>ηOu 764RoM]`-: [Ň{nǗE#ʜ}z`~Oq_>GI'aU\ux\1:۱o׽.B[>Extz/,.5/[vSN=n{$^_-?8^?ӛ]{^P-%M?_ͯxu};bmt]b.-{c=TU'?6[?mue׽WEoPןW{YllZXIYU#`i >oR3R%[p9>ٕ51)^Ŭ]`IIanό65|}&Grm*̦3N2x.U0Y\\ݖP4S(hM"~}*w109N4jg~ٛN=/O3_=F#VT34Ԩjsgf3I bo\vT;..3?zLꉰP8]h0: M?')>ѵ~5jA?ӎx<|V605SRe1m?pUԛumz.<U;%ME/x6-+D4*?,m_cܛxvkLG5dsQ,;i"z[ QB^Y?̎:xC M@_Uwl_%vF[g%}d)ޱ+ih04P j\FCc)EjAYxLt!# ȥQ%{)luB;k?"4FM|8}T?M`zv^{аhrt^\ܖD-^:%HyLi; V/mvC`Xj> EX ٍNQyFD!PJ `F T@iL%z Opꤻ77d2[Tw$Xݝ3Y*O yY1#!grO1,g "j@PiO֬X^܈Vi\4J $POjG v;DzyZNZ)LZwc6!tj|FVjGyUJBFQr׹-Zx <|O&zBvN*<{jϚƱh+i⚢YU;rZ2TE X>ږEGa=1P!6V!ncp~#ڕJ>Tj2*~L#h:%ly;7ǮcKhVR *I&9$he zȗY̕֊ !--g!~AHSTB@ּ)N=:+{pR==ܞzՖ#+ 4ڙO,o~tZ*,m +Qа5U13EJG!oB6l}ѕP8(9xz+YY:E&Fl-rS_Ru1uC5[iPo-XlU?UE@z\|G%;V uLv srѭdֆ(jբf_srAEEXHW %M4}=3}ٸ;sfKMӱ{rWԤMZzEpC:׵DTТ4-VZ^WZgHi# SbEav%@źBhE[p1CLgF^xtuhi17[KZsYo 9)y) O 0%В8,ž)bJ&zHƥ 2gOB>]`(QXjބ p鎢I5 zxe})۱epT9֝%W4#Y S$MlxTjQ'='8nfɉld䊖D1197 E{džaqSWTꩥjUiRGО,@&Tpҵx5)\SDUi”*%cVh(aj Dx.L#IblJ"VYXʱW?A@Yp,u| |~] i|B$ ԭ9}(563aO$gj`9:E?QBm'1AZGe 1T9m^; \o{DzʃLS#qcoT/AgʼZ+<4KKBrR.:F{<}sVe82N֢H]Jn7q:1ʄRizy)?u3+f2RԸicVѣQdxuun3XNG2RSF A7],AOY_Ml U8kqwe8+Ag0Qx/WO5'5tr'%{7b 6kP,Y@7tl9dҀҜN&˧UC&_0Y 3M[UE9 y]"y[H2>IqhURʌrik[͸rA<(A"kJ`ЇIQXJ154-ȚaAwTIx=+1;!5.SS;3.2e@BxFVY)˫PQӧ정F􋒮T'M2mYQ\?t豮Dc|yױa9/4ATG4[QLJ9b0:@y4%V 10`OӐo% 8sO3҇B4cנ4Y 5<4RSa$5V<_"jBkJlʋh)VuinPEu+3QҀ^T<|#QE)@>ΣR3dkaQ<Rc髡5eA頕k?7{F82*h+g?>)KNSL~]&'Wp,)]KToo:FJNK+:A c*G#N#E_!F ltnlU\+θ+XRT?5t6lj1uŴL2AA,UBܜMY5WSQˀA?C#6ǥ|oJ"Ìt{;ؚ@*j6Sda*Xx W R<2iQdeC(2"5uXr~z"('8BAaPtJX|nئdJ8eJA@v2 tkk(7Y磙+/2UлP,W"AcԃTUDơVIjˏt" O/y|QJ\ \ttn^YdUB%dZ:dNJ9K$u@m- XD$nǑX^&5j8+f:eo+N|vf(3pCwkLxUlU4q6!{,&j'k}Q>_┓ z1Drz,Ҳaԭ>jk\ўiPqxvmϼvI&/uEQN- ji`A 1?ӶLFlN޴ lFUW5me;GKC5V$z:)cF sndi詩vT}j~]U[Y䄹+&j$SI5|-A*%GKT RFMz1݋=vE.ڨڴ,LsntSbFI'֊b1GE\ԯ Pb IT~a0mzW`c,*bknY*pHqZ~^<{m:=q8i[XS#dMI.di630XdIز+' ?!̀n6}fiZj1UmlP@#=dr&KȺl9E Zb0:jy$ycK.oZuY5BR!S$RR E%ZůB:2~y>WM4#pY(qxre$#ţ50B&jJ+4ٌ@^f"A>:WE-/8JD[Ƴ0:iPY}Y@qQC>RfFGrzr!IӖl9|,wD6j'->CUODR@T'pz:z1dέhkK`?P}I  z6e!kJ5::/Ww/k5)2l`UG<sVG%VP+0e6/׫5#ZgyD(I] M>ͬq&(@V5ٌV2< )ZcTt,K[>K|e\~烫bTнJM8UEu/7ǭН_-7lՙ"Dq}}% |sr:>|mjz.VHY(R6!C+kO4d2U)VG8pG@\>G,X_Zlly_gtzȿ8&{k}?>?=w{aeR4I@Gt{}g 3ܓa'ϭW_{qR~>_HGMgV#G'PDEoU'A'\VSkx͈+m_#MW'_>GאHk[q:e:}o}@>}K/?ۏ{z:-rqNJ~AϼEm.1#q͏K~$ycyG]}łUx@5"~-oy<\/~5O~tQoE6_ֺ=y!Q?n{^_Ks߾ǒ.I>??7j:{-"O~]t>C'ߑ"}зM}VZy׺o=]'l ۑx7cro~?~?<:??_|-up@=h\>Xzq}~k^k6n6ߺ׈ _~9mF Xo?_z^q׿k}\Z6\jW?˯XƒH ~x~jH?<}}f7k^׽ߟ[է^׏~#O^W~->@!Mo?ߏV^Ո,.?O~_{H~uOǾ~=k??N]mn/s_߽us؋q+TSdb8a~qՓoY#6Gs pBXN-O?N_ksk[\ Q#?xhRhOZdw,=gلyT?fOېr}%ԗ?,CUq_FMɻErkV7I 3>tG/sO {*Xʨ7&-o~e:]i׽V[aέVϿ7ꚨ?}{\r]=jooϺPH驱AÏ^?2y/~ Nqdd'RZ@-׽ጶuD~:C[S61^1mO٨ SWfk ^a.½t~cw':WN*\5~m9|++~iN$L{TpE ^_aá_L'?k}?uk{X,:P߻>2q>}{Hή7m>ν^7M!Ͻ1u׽H>+u*\eo$},y@崎l?eGVuq͹"-uCïNذSϽ}:n9?_߿j>UZ^~ב{)n}Hï{q{MG<ǯ|\Uݬ? uQ׽WkZ_??{v/\δXSol4߽5x_zX{#PT>/"'?zO pFuͿ' \~E}=֕=x}7 W~|?ָ}e_&OŽu^I>^]j{߇Z?GzySu|-~I ?OOnQ| \?g8~nO<A׉^?[n=oW׽䁦[om[￧"y“ïN <_~ϭ{\`?XȺn?↟׽`ԛP?,~~Qz{A #H}yoc_i^Z}ϺH>J{opmmVK9i[={%$zlb>>~Yk#{X??}wLcu^]{mow+Jz]{\ny޾uW{9>8<}B^n/ps^Cϯ{seZ.':u㏳{0WLSO\~`5U~~V#߼RE*M7ӓÑO\u߀n{H=x???`uR^_cPV\94Кuc[_G}E:|HoRKp?W}+pzr^y#ymgCJX~?{}$^J|@6i:~[pEx}lg؃qa5CMR~l^~ſ{nO֩׏0Uk𽍭{˫uߎ?:H[E|,=ڀc@HURCOH_ޱׇ˯_f$oOztxqr@>Ͽuny[tAoɿG_>;ʞm[MZ}x,X>8>x_|I,@P4??6?>׿@gڍ܏~8 u={ f&o}JuAU[r\[{Ǯ ͫHG^׺_|?)o&XsttO|mM< <}}S{"T__&Zc9KTK}{^ܛ_W`z0ڐ}͹ǯu{=сuZ_{^c}\yVI෦uO"ސ<"^!>NJuǟ}h㨕T*"55JʳZ,~/oE'C@O}*O79+C>ck_P++g5PFf6 ,TAm/ŅtTFR])T[xJ$VPmd(,Ԡ W6}_Ic'2h]6SAe"h?]Z=Gb@AS`lOӟgx(qўԤN^Hϰ 98d]cb$Tߛ~-vGױ /,RL;AP)w+_)U\r e-@u0NoΫXx=̏7nDLQ1UiRM}O&2k{]zr:=" ~~>OaKH{rAk_}lO8>?7KJMD-&#MDQ%Xr=F?^z{X})Ž9"?ۤuI:r?#kXɿol3Tq95r{C(U{s{8:ONd8?ǰ~M==~O{z!PzE4B,Uj_X]n/ Ϭ,,xEzE7\{xk?{]={qy}=xuZu|P? {Zӫu|4/ִ׽~}6={{ěGs _`&QKoQ;WgNv[#QBn-oˠrgRڛ['HyRSOz='JzT(h&S1H?@ԫnazW i O5 KPps>]hYj)OJ Uj#bڙ. 6f( 2%Em\K=$R#>b;fgE7o< p ?>zl_ӛ=ϧeIaoǿLn׮Eubyqad7bG'vU>]e`o'o߮E?Q{Ǡ¿ϬG>_Y}Uu4Z=r~l?<Oz"Lx$[s=ik׽񽉷6?Eͽck{#HQrm`}ϷTW[{"?ֺ-p:^Q?BA so?>׺e$9/k[׫N u,ou<_R/߫^!R#[괯^H߃&?$i^J|#HV~G^˫xuv{6PF24lN)@dPJD*L頄%8+>:@<x*{d,H4M֫㜽dl7|`lJm@vҖmR1m/[-wCSEQOr4Kvn͗ڣya(O&bdcE$zߏDAcd `ՁKZ~}IUKn79lT?qvșyU* z5czIAmmٸ\7vd/\VSd;oNЪ >:<w &Τp<8t \|m[OTum;7GVɨVϤ39줴I%sT~qGM: ez筎aGN%By2'sP <(+\@deVЏ|TlA쮹Nz-![ǫͭebuiYZA8A0P;c9eyhV#M`#OMaNVXF%r +`_H7BUL}"4j=oA~ozc m{gǶ*ji#U=*Α4r,D:fqh:,M3UQnxei˔׭Y\x20bέd><))یtQ{?v^ly:\UE-F/h%X>SjuZ!}3Dz$)Qi)iZhd[F5ĕr5f cH4 W<851_ $g  d1d"փ5cL\Zfojo%m^(Ux޲yWImlP~-{};@&#" q</-y,UJd؊2 Ic]"?fIT쩨&pe}lm+y Z m#iSujZ/*1H)˩8&mA?rH^|vEէY*+w Ǖ ʕYBu񪏨ůbo>1~Ԩӌzq{ ;0;G-;pn$Tԑ!?vږI猫 4@X2iSV JO<8 qUԛF#\T^DT)kLTcVGzr As,<<ϡ{3m͇X&Tm}L<V5>w1:Ds\Fe9 Jp-O~ޑW@R3xuyҟOY<) p*e#S@ѺF)Pږ#s\$f :94ӂ;W$y?:;K-I51?ΝCZMZ:,1eVSTKD@BX7je^oPWcp杠\{[A>?$q^F\k/{P-ưTKο?sLttg|+9BH9viq~Z1__/*ұ#ʃ4WԺǒ*yqU̒X7 6!X?Of᥎%Yiqr.U$݁$wR,Ë,}1AQOJǧCTc0L*h+d4ޗ+ ,j֤5PrqO13M(Q̪ , SFm6uy+XccyuS:MO>ݘk3غ ݋ueh+U!z#%h%%mCN*1GPGG,"Se +qmDa}<2*ah@udurud>Q&dqJՙ-!C~6׏ƱUQBg* Z KX:\2,G7mu*ARG8EyՐ+dO}۶rYq`Q)rTI]J=N}&V&*⦬114t>krrsDS梘'\tx4Q{w~Sيŵrr< TLH03'*\e4129:bA}o x]?PBK|EMe* WJF8֛6 PI6\s0 | G$>u=k!kZypǂ®f)XJ^KQB-9:Y1n( O*(IuV=>2I{?mcOjA)\J`7M*\}xԸЯ =]O88 WT9bJTV@ָupzl6J#1$S IH!8@0RZhxp酌B(|8W#Ӈ˥v->2HC2kKvj$l axRU$qxuS4| ~Vc\N[S{IcqTbRW@*$6TT! KIiVh$10e*#*{3EWz$K$I& UVPtY[ٴy)>1I$HG-r[#p1vԊF}3Ԟm{(}}as_8_Iy4:z9ߛO{Lam`8>$}zHrYBn-u:?m'$sur)ׇ-{6n?>}:|][V '[x'.`O'=U:~ jbJq?[},y?F}xuo8 ?NE}ozz:1pAn9xz}z6BYr`l=ﭜc6a#e_ǽu^|6??=u?}}sƟ{::{KI>'m\G~׸u݇ʤrt = }.G\u(}E?}ouv8=pT__ןzd"A>ƀY2zOG"xOKG?Gxӈ-YW nDbo>՛*kz~/џe; ~E5܅&Oq}Vw?ioEy5XxAo{{qYŝDũAPY~rH]YurDSf` qCQëF ])X5/߁ϗZqZ~}{UL鬘# f\7?~&$zӣ\k- }+׽Xن+?OǽN$:]luj,Nte$s`t'Tŭ%W?.4"t{[W k6RXdu|u^i~}kO^"HqL׸u~P~?.ï{pG"n/׽T%?~994tcn?<{o~Gϻj#T`.[nmߋ}?~A^GSaozzmb>oǭˮ=`O}y\ \Zo^j굧^k Z?Gz@.D?Zޝu"7{s?Bu߾mp>[{GO~ uׯ{^Q꺀{߹q$[۔X׽sl=X~>N__y]Ymr?x︿6x|zu}6'Ҿ9X㏨}8ю<^ U6ovq^x?vOz^^M?=Z׽[/}=z{% ^܏=?}{bIp}#7 ދֺ"Z s}ލOϯqǗ^к؋?[rsíҽ{|R@ /{^#_~,oc{W*"ăn~ϻӑ_Ϫ^u}r8I^{8^2 \9~S^xj_cP'p8zNj=l.I,.Xװa=Zuju߾  ɱ?˭u^} ?__یP^]t?_>[Rְ^@mq϶K5lq,?I> */X8_u]_| cf\{x(Z믩?AG]u>=黸[62,67%H_E?.q׾qͽCz,Ƚ?|4={۟| Il8$ߺ׺ȵJXXo_q|:_~$XgWq>{`@Eh9q^W|m :-q ׅiF?ߎ@9n?Ӄ6{{Ƞs[ Gs7Qu:sn}+־qo8Ͻu={l!6)aꦹ׺#cc}O7[:_?-@o Pu{Jեy@s4v/o# ~u ůo:*Woa@*/v?,\:?u̬.?Mq^ >Oߏ=l?ޡm=u+mM]?>q׺? }x߾׺j7a/?KObԢ#~~?.^k_C`-_׺63}>sOs~uBz6\[?{u{Zs}ǺG}G]G_yonB4#э)Yn6u`}2TkOŮy[=2/jF#dlR2I/.M$16d6~6,n6ks n-n?%KͪD!'.>-dx$AlE8?})_g\K["u00r bF)n@"7[$'r.'%qƜ>]huSʓH"{i:RN n/ߑNN"oRߝ ؟c6oO??/׍z$iRb\9uu V7"ot{O!WK5z>=jPX,Zߓ"%[6m?}՘-s?/׆+XL.T}Me:dToSxTA)_>dp<>_oqEi%?]ya6X?[U7ͻE顝UyO'>ɯ#9'=ig鎆_Ӯ]Ii=Nڔ}DO.ȑoy_z@aky>}nFiITG}-}=S$1Unt^}o>`*|r2cZ:~VK'x An{$yꙮ%PO lSuϡ- F} b X?}SNsҶP؛k6kB?ؑŽGOP6#$"֫2ީ'Ӝ|/bE?}8tŀ7Ǒ?޽5-rGO [0>6?QbN9/$j1 1??_o^5%Sb>{#;Y5Ƴo}>ϳ_i?\Gu誽{{ܟ:u^)׺@$.l= Ao{Z={h#~IկyE:7Fß6\tf5u%#Tܵ@P>go fphO:"W')qjO3;+ Rc:/#Rqu_rdw[fA8Jj[:#^k|9gV )|}ΠG5>>c—6|i<2Hլn=DT}&ƪ-Ă鵵$s6_SU+?arE\N7CIr``#y󉿻Yb_LIF_7Sb}fAhk:c꿕eRGq< <##F$8>3u.Atmـy=<j`|_gc릉_U?޿xnD:{-b>c}]7?s1\Uz#:'_~}< uPWϮſލm\~ӝw4@`W~=Z#kY?7k?qi]$>}w4?ןG S{[~O:{~TuW{ocɷo~QG^nH?>[{2$/օ3׽r~}uqHOg׽Ҡ:zׯ{tqm?M}>?tW^#Z?}} u(nI 7K_z^pï{uIeA`V@ǧUu|׽:lpdj-]0<SUQ5AOUf8nU h8<ϣمFpEi⾃OT޻!zӘz;":yޖl4( `eHky4O ^]V[e෶{o!wȊټyZlEf(ښ55ֲgq*=3CaVgBq>C?.>#ݟpc(>R2QխS3vRv)^|iA~՘*YT>~ kwOeoaf;ndu՘ܘ꺺]J(d6娭c$7Q!7GIGM|T'YiIkC"~"@(m.<#R03@p1_V*~ܹ WggZo͹ԪIEK^Jsʐ7$o*d"xwDYzZt m$u4ιirVT I,QƳڵUXHFk'&C&HR0GA4'Hߏۚ{n0O]ftt& ZJxuII#BQme+pPddjο|Uf1Vt<H@}`f@&m(JWf~YB<7ɮL;7ZbXۆ*6=j^:(O4 J2cJPgjjc IKO L$HPPK/6URjpk@pzF u4<$|FkFLvJxNs%YZS%igr)X#VJw* 3O )iV4rdE:΁Jʛ "J>~`OR s@)AƘW'57cuL̋K xҘ\ڢMOOG,fIy*X=%PqZ2S PMnBMʑ{ Gmj z y]q﮻\V9,R1\fBGmR1' 0)$gV zIP#R@ܭpl$`̬t+_ &2?䑐RsbGѭ]a1c)&8iC]2cC*;yƌY b6UxYfHKUWT  !.Φkje{Q=#$PVI^CtmmZԟ,Wop7+_$i-ET(tPᰮE3ղpx&J>fUn~:bZS!IزĺOwb؈2=p~T}&HXBhCvtnդ62U$XZ_%Z @j>ث\I$2)erͬF&6%x qpnǎFsњ߷ עW6#ˊV} 8M LЋ٩.X21r|bH,A&1j!.@>M2iiAL\?REOUnaY)TrTL#u5.ChR[8TJr1X  b.,,=E#2`2T?ʝzO$1_:TMU޻ʹ*k6 0-:daY*֊q)59OaF#Bh)y#YG.48M)7r {uӈkg]ZJWV1 X 8?%СjhM*H?gC;gj8)AION[?tØqPIll&^e@UUlH8%B(@4h)OVrIf%HmbyEZޒAHQ\SrD6Q_kyQ7v? =\鹷B" p8fI!@I܄b|IicђVVN@*G?[qUė:NJLyyg斳*'ǠTt*MAІ!C$qN\MnߚI&F (SIL1 :y-LA\TSg5k)ūUpK%7s#p^"ƴ:v1^9^WSh-SsCmZ' 6'.c+`X0oմ R:Wx٢eU>`X A).$ȡgmƞ!JS'z(c6ZPPQ#*ԬHL8T\+K:0mAC[V.z^'W#0LJf${$\XQ<1X%͑K%Xpܩ{ZUbx0O>}prEMoCtAž6]ŌJj`]U4*ZTY'!EBLId}&xڼfAcMiOQAl?YRD]We,y*P(@x2=:~Tmy=i'o,uIS㮂wVj)^QC4Ό*hoq26PnO|㕮BkMI3=uCA0LPhFcϠ w(o.zym`- P`̈Y}#xSPFKX?OwN0BxVDdQi۪-dfhr;0өg 2EHj$Ȫ5A aebX aIVSA%O {r9F{y~iN kRO|Pv4/r[9_#bH+rȂk[\k6>sy#WZ1_,$l܋J^_٦ I(N535餶 jGæɚyjZx)bǍ1K%%)7j:K)MHI ܅$@g>1) _ RJ)YH57\\p~B=f>*G)H^?.饯q4ujbڣY~/(-Ğ?(^-urM HZ|\_WVtWM$yzϳP%T<̤F9W7*H&_ u֭]e DkNd9#j$؂ll-k} nR6.sQ_!AtI}2`AB[F19ժFGHIY)VIed6#Pon*jiTki`5a["щo.suMƁkƀANGQCZT :pf*հ6>YBFkx4rF@J(%z'UR빷6k{1iң"$PB@`ww]Sٻ!ǭ^ү+NiG-MnD"ONj+|V ,W> .45GO=:4WHGAJ^"=-Kx! 4x]N66RznlnJhLa/6RU&oU'1h@Xq+SK9@5<,[Xɵ!MAM"lmlQu&& p~ML^^YrhVJV*y∳x\nx>* [qܟ0B$ oЦ?'M|Hjic:!"+M{1j 8х$%jMGs}{Gf hnL}f*m!F) }J'JhVf e2EqOxl;5ܔ-Ay`$BZjotPړdbm?iϥ21Oz{cdw_YlYݡv;qૣԅ#/r Y=<ȢHYEAj ۛq?m#us>N?zz{u1u  \{miOϏW\qs{qk~7XuG?QǴtcQ|oRmPZ>i@zFzk?S͸pGݽ^^ׅ?~pI~?}fI[\Kpy߆ݏz5땸 \}~8y{CqxV`V׏~-׉ﯾI(?zxM8bdQXx~>O!W'??<Oj++kzA$\\ {Z'_=b$~Sz}.O'_^׸+{s<Mmk[.-ן~xu +qG_}~W*E׏E:^a7?@_mשDߋ}>}MqxrIl~~{׎z\q<a○U?K}GK6}`Mȵ>l\~o}\r>ï|'xq}\@#6ah |?pyoǯp.~O} ~-oֺGsǞllA*~}=u}/kH?_}PO"ߺ^coӟ}rֵӤs=w7?}~F?￯uÎHڂ?^}&,y,}_BR޺\GI*$q{ӱYb8ߓ!2GI`G>rԧp_=ɆGUm~N"'_0J4CNU O|8xc]:Q*MO)kigx??z4Rh%76 W_ׯ!z(@`ޣ }@׽SAFUq?~=s?^WJw,"@ZM8U<<mzeuKj#{&{:4Sh!jPu(7~:=Oϯ{nRE%O_Q]6:g3j-{{Q`j(D'˯{v_:%HG>F6-G>k7[v[dŤ+n6߱ e{u\5rX?q}:SϦo|Cp'?gߨ=zA{lП=k\:Zzӯu|:O w#o['oA66 Em'G=rQ{E׆37?7'UͭG` {ڕ,.G\䋏\U<\Û(hO^>sh~޽]67￯>|>}lduU@&6N?>p.'ׯVxOo_~'z^=ꟷ|xl>?=莶ze \sq#:dlX"KO^׽pEK{u}7T _=Ozg{K^Ol0[ S{ǫ%L=z1܋~>_<g׵^\X6_'ք^_|,m{n>ȿ>Op^9ZßoǿP~]hvZ} b]H`$-sލG׸{<@''z8o[׽o}=w1ēׁ}E.m[l=:]{#Q/ǽq?^#Nܓ սЭzN nu py?[t#[{_s\zIZMHb.=Go<{| @jKnĊuq?_}[PP0+yx?_lBr'(cd%ʕ'۟Q|}:GƵ=P޺~\ؒGO#G~='?m׬M$<_sFN:)NGǿ$*XG}`Tb~]{u?եř矯oVuٖŸl?'^^I+c`Bc~~ǿu:}@vVcN[߁{<~??޽ R{$?+֩}MK[\}Oʿ>3cn?C&ʓa?[W_m[G\68߃]oco9[>(YHď'ߺ^AR SacxD5.}7A{%Gpn/+Ͻ׮yao}-$X{&E-Gu[.>=6buG#|::_s得9_{˟O^-}{9Oꈿ?nCJq_o[q7u?#>6m Sђ,8~~{nYǣ{~֪͊X3P_5>C\}B5k.XܟǴ+@}:*T4& x*E'4 ZG x*Hk17!I9UsMl QDfLzA@(8$>:I!"\K}~[_P?Gi瞵M]C)Zgj*hF,փJXXʧխ'Aoy%G?{I68c ԟՇ˧d<:)tQkptTцr}<~/m$Oُ?]ad6QIv M:#FʧZzOi*msm"Nqgӭu3$,jыTH<w֬1?X[8cϧh/*P|z֪i3tYAt}coQA2RHG7E_xe*M}Z3L]yq4wPԂOŸ<&".:p_b?~O{+7,cWѦCLd K޻D=F=LBJ XXr>J[](kK>D_?5Jat1lym#?ڇv?o~f=;TD~ΘrTUI$qqIsnS(>?{}>6QC5mcdQh b}@H~oB VSeE~:rCԠz?oOa#MLX)r?kæ$+>6n}ۊ\i {' >?R9~=nl oOw<: t@"o``y>qq/=VzA)W>}NZyi ?àjGY}sג@"ӝ{>kת׽Rsbꠑ׽٨oW }=zb?s?O{[y<;9yZ:>aGbbOdi$\pKMmtcȿO ^_5xGDp}>aϸ#q/eqJO!^x?o2O{f$qH?? uqݯ[G^^}>m~{@pC{Z#{&F LuVK 10P_߿ '^k_{zX?NW..x׀?j4 *EMLA--y&:AC :T_Ϻ<I㎗B!I8 ]{:S3ӽ-Njrr JMr*Yj!fPceB) rłǗw^;@Ix8_.CJҤ=N*|֨_o>s&{rC6,Ư8T6Ш=khiTך_;ƥ6w/⺓2ÌJ]IIQ+s%H3^#њ: :ZalOEv_jI]le9vuMiથk+5:G9uy`S>%VFDIOVy"U[JvIR%+RsO?LtQk#AF~nuHW;9.gvd>$!)jSKXH^#-:$4Z%_48b&IoYb@2:`m?_iDPjM*x ="*AT}>T؞,ʹ 8tG–}Z#k:P/;Ldr$i4E<-\#mAF9n}__kbd4?:e ځ<)QJׇ3XMU8z՛Â][6QW]bKoPb/)A Cjh!id]+$(cq}LIBmcUVJ'h}8՟@b4'OI3[xWhn*l^rLVLN.RENeeBm bQT ZiqyZukvز&Ge'N(5COS2:gS dz ^cdRX-^B|~KOS_NdvH <I2$zsKN FqPr[:iAyt. zzj`U:Z+"F#,imB笱S?P!:i?Xs}TRիh2I*0hhb>_nH=! 55<Պ{|rCzV/<}SJ}QEA<vER-{ujXEqR*+ %>V:nխMM4&XaEHKgA"u}~_˫Ø9χ[Gl7aoWEcA R* 5I1VE5u z4f0mzhaZ)RI3:DO:c! TN#yZM*p486GxiisU6DandNJ$5B$0} jAp ԰Ƶ#2>r=UMLԛwi`PS)bҊ1Gm-4ԵJZtZȓ&_KRݭ w9W>YEw75%Fq3_t,fwoҩsy*1Dq)#2|riNXSM?5+ER؀Nme6HUbsU2>t@8rfm`jZ_JF]hw]-\%-Ly9d*VHbgk{ॠlJ rRdP P#P-lFjE4ӷ+9')=]^U2|~މM*829M3SW(Q,MUZiAM+8$*z-a{n}=G uevZd9&Fk\W#G92Q'jؒ7`͵O&ZjT3ITQ,9A˾o-ZhR|'k8n>8”ϟοRrو^40Lұz9fD$<[MCIM|=QMAԞ ѵW 'ӊ6iÍTpAjBFh3ˣ]k0.;9zm񃩨Qc[SLq@kJQMp{1q1|L,H%)@@Ꭲ@[lTrphGOI{D{7,ZˍwxUΖT*!iS7{c̽yb9Zv$]KDA!kـZҕN2>F1hiOt;e253cZjX*o7eE&?Ef^<++[TK&4s^OPLZ' 1m<8]w۳<:x鿉b(dhk[ *(ZEm54qS-Z/!Fn}a "tgf)ATsSlK&Ļedd*  Yne(j M!~AVh}qb8Vm:ZR'e6\ԳIICXgX؊7:nlge1悶 _37X&0aX<\"vh}1Jg>5F4qqelc&jm"Jգp6 pJ>b'Gɐ5XYT%ބ!hjHϐ8|1*Lv?ӵYhz*QUc1͓0A$eNK,ZD} X`*d_?R2@+Ou.1yp^co㗶6ZRfnJt58|JEr*zgBe{}aqDqLE*c=ݣSqsoK+>Ҡu?"G=&f 1P|H$GˠwGWJ:Wbka!8oHK*Yi2A&i>JA5JC\@it*`.9BQ+iVJ֠4BV1MEHu{ cFvTXdUlL%`UȪGCʏnYzy,lak|_niZ?yVGԥ[>T0gȎ ꗱ>FǟHYAWG8ڻ/G5'amME>JWSR1i 9D2h)[CU)j]O輾CM#GvO\elY@CJkÉ=TJ׍G5x͏;C6N#HҬ$#ƕʘHdX)1EffxGB)*FuI T-ZH4~_]`p8g1%ƫ4_Jcjq[!2Ƒ$T,Q4틠ˎV֔-h1<_eŵSYm=TSEr ]+KMszqM/co,~߬,EKGIux:V5K$.\ Ѡ8F2V0C(֪k@J?KڗxƍF'J.E>kIȉ^J]e y .SUSa[ؕ XOQ.43X[Z; TfG҈%>#89naKg%a-SӅ:}|f6'PV?t`eoPnX ~ܔSg,EQLja ԢjYcIiYqP/F\6+s~xDC_L U Kg*'GONi|<嫲:((@2=|{o(O;~un6uO>Щۖ[n_58١^&2Sn5 )fժ;j#) 7Yļ!Veը(ojMFGNGIs,u^8<)ZnuNbmg˱\EF׀'&l>bI?K}o{O_}Ef x?N?~z]#?V?Sk/-{^{?#ַַ-?#o}x"G6׃u׾<}?ޭs<>N]qŇ#ߴ܎8j?Sׯ[WcU~G#׍G׵\{׿u={n??~Ož.z}R~y'|-{^~o <ۏ=u>H(?K::I?߁Xxv=G8}=ҝxpO=«Ѝ$i?_un^1VoY{_}fm&qz1A2?>e&[BQU/Q?>G򷆵\C''cϑP9lQRq?OcmYk=G?gjq-I`! A ?'t:MoTV(āpG{ѩyu}R%MHHt<\/W}&TSSp#9_~lRKƍrO{r?q) hqo6k5W׽01+AC0Spu^i׽1nO Zߟ׿uZuoѮI6^kSub̑RZEdi1nQxc+L0z.]?'O\GHN?#n6`Jeo{~mǰ.GB sz}O~ :^ՀUر-y zulx XAp=^o={ߍrY}שN{}?xSuV䓩<}MA4<|A{Op$Z~??׷0TuC/9?ֿaD xo߈ƫ}?_mߏ=,x݃z˭ֽ{6ˋxX=j{9qށt[߁o|￧.Iy?}׭Ӯ#-}6p?>qȧ]{F ,l5ɱ'ǯ{m*EOX[{{q)MC׽aƟQ$<Y]|>{?._z"@ R:^?COG{5&6={+ɱn=G{ܱO^~}k^=x ~/s@cS{J~R?Ϯ#܂-C^ï_cqإOVs׿g~pXϭO_゙7Òl=?Ɗ1uqÀ8?[s׿^acUew5~:Ͼ\GrIlcNߟU[?^q׽~,-?{˯u|?[I>^M?g^$\ۨ(1֍i׽nM}mʽP5n>Qs}=;_>uzGMᄐ{1ש^xnu}s7y{:%܏?=hO׉yVK^\7Axuu׾ʼnÑm~l=::"?ַqhgϭsbH_?6{fgl[vPZVy-?{hc={Z,E6{pz^x6(tٍUG?>Hr)bZ~=ӯ{fOYs?N}/={"O7^kİ[Ϋs~^N}vdvީQՀX=:y&y OC^Ar'nmnoԨUOUkIH An~ío@ЕfĪI\8:U(55q׺b:HW`_poi4rM^N>lI7zT^_xb[?Az]DiAK}}>s׎z?U[E׃aׇ^! -fozz}xoKhjP_Z`o=~OzK\ܛiU_Sש׽ʩM7$}& _u{'`e!X6X<>~UJ?O_zןyMv{$O?$[^{} ċz{upߛ|:Ioqoa]\>Mo{uBsecqmc^Zuy>cʿ}boo&Ч?׏r&'_=CSr_*[2s{|CEMX:t#+~r[aLFgDCE~ܟuGa՞ۨWV~[M*K u5&eX,A~kqaa4M5'>8O110*lk TZ<}=񝂡Uyqs'n/WQzy yU=5yFHO4[)nB\='SJ43?kߏVkAQf`WTH#Ѫ rDRʬN>nP ܓaa?^Gd5j\zuV}:q㎑Eق%YM*s6[{YEH/`3g~λĨb(st ǁĕ3H_#}K{Yk|tƒk麵i&g~]J) x5j 77<\pG4?ZLхs3*AIQ( GԂ/n.lH'Q?Q`"_SQ_uMܣC$a#o!ڵp=:Jh[̿a4At#p?6.Lzs*n﮷ÜieB%KPX=ҮwԖUk\>?|>_CT[Gpc?f(/})@Ƃ1 G~GbW?>d~@ÉCG _d0奖c۟{\|zX"XZ"#Qo.y}ϵ+ǫ4b(ǴUkAl8X}>5&WçgԞ+8m9@c y=6:|~rX\i\=zeLtxk-Q-{:o^ H^N9d[6 yZf~ނ[Y={Qw^s#߻Vh|mŇz?"kש׽$r~݀ꦽ{AI oe^*ZE^f*y7^~uqCON]"aAb^?SGt(cyѷh.'?pC{Lo?:>aᅪ2X?S #cjaO ^_$֪MOb>(.ECǼ{-s1e4P4Z]aj~ْK>= #j_ooJ.Э{@܀I*TL!q7Bs#:dP0I $@,M)wΪf(%Uf oǷgaNǙϧtw:z_Q,]"U@BO, ?N lW(.q>6J4~޷VA8?XX{]4ܛo`oc]?A-ҵԏa*OH6㟥X~WtDQSS_~}Dʾ}z?qo {~#1N1׽'Q}?Rzi}{.Wz^pL?}5??oY>`xV&ע7kPz3OCb/={+GZN{n?"')c ~}l^!7<?Ezs׽bI#IP_u:@s{[{-oכ?n_~U}F`}omtZ#O_ըr}-TUh<A>> :x8\BoGZ xlȽ{0i׽ Vc2)T(|Qm4Dgr4ZA7 /hZ '?ˣ+$jxSnzlԵ&:t:__mfj2{sVNū/TcHxW#E&z c)ꤨA}xm|enjʌ@Zz,rQҼI 'n|AEWbO (QTb&4!KP(-Q594ϪV`=ޛנ9gNmWKӆpUVy32MI -"53YZbG 3V4""TR@$TdJcr|Cr3R Igà+>IQ[ob]u:quUx>y$[pd]"LnkP˪Y:js[I(⚷+ajjiEs,kYt 8ɡ=˃ZtG:w{vFە=w35;K7|aݕYJIjd4h@)\.Il$s`}#{h$~_˥*ϗ4)hsO,y ]$Ң@ttSvT-|W:z \r|,0B1O<_3O,x'XP}L[1KYS;GANң4f].EÐk/h V HjkORyE*GQ8=# \?Jmd)rrUR:6%i2PIbO|2 Hdx}ޛVlx4l@jZ$+,xlq4Drd1)V*!(aCXEXDPxXX+?V2M _-Gqdw=l8jܜ4$լ c/4'#"F*i2I3KP!pY {6A{6tt<Հ8|?.A$б{m5;3PIKEH!Ɏg /` m$`?G*$KR-EQAk%KpUmt4SZI8bĤ3j,~>:fd\a1D]#Me2UTiS^ F'HHsE=IuUT۝j%M+i2LUǮjZz,<`ڔiꦫIىUUTBԫ' 12GLZJQq̮{bd`{ ~O}#E;Qhh^'S+DZTWɐeFҪ`KSYTCG>ZCYT(5kŇ8N\H8AOSPlm(r퐨ke >Ɛj>ޢF5Pcc4RgbĭOn$֚ԥUm_cbEݧI?Dح8^?.zS.SRԟsC==>BCIhtR),+BHVfgJ]/2[~|E&ECF&() 3@R/4,BucH4*A4f8d1/8E?M8M_1ǣ{VhU?.r[Lf.d(7%eZmI%LpYD2GN r="$ZQ/i⧚C(I^~ %+Ǔr=@ 1֜Gvl$Jф`d(%'YԐκ1$MAOsodKIH9:",q#^&"pkOH i_M^)v`CRx'w,X tUA2j[.>۸৬T*V[.)7 ?+uԮ Q N$q7}R?.oISNASQC+]NVCb-abK5^tix),BKFp@'cȺRHG5>և*S8>Xs# r4ZVhmRPj"Iǁu=8Ē#QPM,]YRT ?t')1WU%,ęXt1S 0,ZUR,MgV&i먼4F7(tl-k'"O Ǵ<5ҽM=+CytꓟPm-8n6%uDPz)K63+VJ* HO )5ދmI@5L@~TUCY|ħ,N'z|!IH8lKEQJSGYLJ&a5i!vVS,/GȆħPy6~!&3ڪB&@; ٸ M;;=eRRMQ7ipY+ y6cpߨ$[^r1Snaᦢq3IMZ)!_ɩl,q6#=BsFc/eb:GY'xm )*Tu(h*=2|( 2xpezvcvs[x#-@crL5&"%D(+3j\u>jYT-,E EI]Sp@8yJ%Y֠is_=)6ǜRt&?OԸR)ޮdIIk(c@,(w&s\XnLai)Hwflpp}=jqƼhf~ \p*pqҙPѾĚZ:FN}6!gv%UA8qڎ|ur]Ld 2SE2DxQq:55W++ CN(8`dV БpYmgvQ\yNy G]DT4j rƒL @qԺ+cWb^?o!k>=8}~0)\|G>yjh%A@P>$kW86Ӓ92WPn͸ؗ[vQ#SM 2$x>^'P&uRo!d'ŤpSX!}@'>P߰rckuuub*`+qr Q5G/$p3U:4Qi „ȺIc@pH>{4*1OhX!O<>WdS 1k7mGUj$)XO$Fy I%,$f}؀jiizE ~mop\A< bo"?W`\MȰ[y '`?4 G {=^?~,oy1^/[ăa?Ͽi::񽇾7Xqo=㞻6^"?[{tb) [{k3ט<{X?YAߴ^{ (+=uo~}{#nX*s|8:={$A*.EҽluoLAQk"^=E_M<Os~Gun݃[}-ب]>KZMɿ޺^=X(%,G~{qp.M*{>ׯ~}uZ?ď{&7[u^?G O]k}k<}y~~]q I~EX_?R=?|o<?C~ՎmN8}ܐ,+Nqm&Qu_ᄒMz]78#8[/^ǭǏc}X=zxO\o\W^}}c9q{{םz3E^&걷ߩ^D>\On8[MoN:OC%e.-{.sSEoY#ysM"#}fҊu9MĖ6{˞Pl<㫕6?!?'7SHZ[:ӳBc 7&'Q(SIGtuK}WPt4Koǟ{L:|N=z[C-*`-}o{4yi!:I"ŭȽ_uu^^,i5Hȡ$Op-piKumf7]<}yotLI{ A e hՔ$܏>zJ t1T[ܟn9zqrTO}{{UXDWU&AҔ*?ۏ 78ǯT@.mzxXX>mp^ߛ^oo|l #~}֝luo}Z\}׭} ܆}{q~N9_y׀?G"7?nyG&ߏ]{fn4MVJuyV Bx<{:}zD6%s}d}hȸ ,?~ߟU-׽,HX?Oug{+~^yKyb*O׽͇7{kï{N::\O>s֩^ &/ԧ[:j?U\[{߬?_  y}b,ckϽR{{@6_R}{^аӤMk~yj={{p7 W6$rѵ?>uP?! Zq׽񰻆6`4dPG{rW͋֍:X?to7#z׫׽(9}˯q]y@+F<>ǭNuScW6??uu-狑k\=h~?G?_|7')q6:" hX=u߾J4Sͤ ܋}8k]i㟡${xuݯJ5ğU:$^ߛ~^s׿+p_tqߏ?QN҆"H o<Sgޑvf~W餋zޫֺ=Fe" ְgqc[7K'#\\:]ƽ 07լ~y~-u:kOn6O.2ͅOoz^8msj><Nzq{=@[rH ߑƝ{&Wl= ӏ~[<\}Pmuq?=y=tM?{^#ߺW]{΂A=Gcß~׺>7XfcI}zbnj6N)u~{~ϣڢ6~@?>BuuOے~*HXQ`}̓><ϣ[ LZ5`c&fJѤRJ H?Of9*XUG {/(}GꥒIRx+:+,bUX{P?NH+Mhڈ$X#ɽP<a׈_ϦʊmkiM:VlGr±R:)~p/ɰI~Wo<>k t=C)[ ,B1 fM^N B>+o)]P1$s/~GMUsVw(e?jSu[OԀ~zbZ`rM7^uqſ???ϭ\8@҄0U$ U2#Fey! @{MqƼEx|hXj|Sk%ZVuP1 ePNIXxl<2G@OX$.UP8>.MOwUnfC.f5 u[ Od{ @Fr /FKBקC\6-IZr>7o`,P%Oy" t2^F!cЇ6E%:wQ*-sKnEs˭utˈEXX}G=V:OG8ſrT8oQqPxAQBY}D5?xҢN?>5Òu6_8H_?.:y}GN?}Ƿ)v=8~bOÝ}M#^߁^J(6B+zW䐼}>=/-^>Q{{PKi?ݔ;?fgtr'ԅ,JG~>t{imt:^Rc{O>o]{{Xp./kӭV{e q~}{,H܃íB.Mۛ9yudL_:~3Cz[??pEby ̿Ac,_7t}ϰ5P۟ץJy} jV~°iX0P[1`/e +^O˩7A1ǁ8P[6M%KSDA MScoghcBFq-o~$~}$Gq֖^WIx/_huR0?gZnVoP$Q, ;TjB0"C-\d4a(Z_.5uf?˳#'fmIJ.T>nܛ9ʸ mkm-kP}zBRHQ&Z{a7էÞFӏbݰԏAMO=:8 T[=6,-`{b|LJ.1a흏ܛqu[H6{EkDgIpHs97:E)*}@W^o$ʼn^=x8I-<~"t 2~y%a>ґNi4=:;kGMuq΢Mq5boN^V~>As枟>~{+_5I׽{V^^?>NJ ]{+P3=Z^5N?'dzz)2=UM;U,1he29t: RS5ތ/H–-Y+*Dx ȐR5Fؕi7KIȁHT$͓y'JHDS<~)P&?fFE g?M$d3ݭpA[pCU&xhv*\jbwO}Ҷ5h([J SBU )JOU3]R4~+Iƒ}<>^_oF6ɥAeT@/ TcGQL/s>'en}-vohv'(d25TxV/ TIEEO4g1Ï542z#}ExjeQ#,V$ E`5Ҝo :&%O]jڙޙA(6{fjUUij(hFf#cD 1ᯫŽcQJPιOˏErN>|)]dQ0[te<>[:XS$xhhΈ+FSQRX,k$=A<_Hǧ|r NJ`Zj-odc;,0 b7o$#HHÕ(>M|ZO*ytavxqWByKeLcھ+UOVciTdHԆ2"kUH$cU$="$iSN8&Et];G;%[xVTpK$o>-3Xð=)dC5!ܕ$)7&?C 4GO꥘1隒|0Y^5tyUuqTM F1 hQ)x=L>YCC#Ji$cs*Г~F}i<*98S??ZЊNZyW W {lJZL9%B&ltJ`Siԝ /rmQ35YA)$bPOut,$X8:1P9R=3=p:mܪ6 -Ub&O&9T; "_*(Tj pfgn Ck,OM~O3 c/v]1l-U_TJqONL^hbI"9lϤ1rrx(&J\-<_s(AFfĊ5#O1{ѥ5|1ޚpfI^)+N59 +dUIN̍*뚮Xc2۩GM"(T2Xr^'Śt|ϡ:eܐt`lvVs3Dex*c\|"ff*:(u?5aԊw4'Y@ȈQ(X2BѴ'ü;GztbfsydpsmE+ˌƱe(YG[35d!:EAPcu4hF-V*y\f{iW7,$R_OX3:yRn9eY$)wPfц2s*Mb|n=TOU]4Je}rIMX{{\$ώ{q *p>(ީYOٜuH2%-^Vfgݬ9$GKUWQTԼ92BIuPFkQpƎEęYCxR?:mhj$RH#@76;;ǨZ'IbVFA<ҪjC;137ՐΡJ0U5|N vS+@Rdgfy:X6 k/yj1T'#BXRj,W" Onzڱ&QPjZq@m%ct8)^k`3!K6J63YG%[)(ً2hFi`G?an* 0QKm\c1)נwVܽw\RQUofZt?J$re(U-Ɍ.| m+CSx]00L@qdO{ne`bGOE6445<28г;˷j hcm.T⫵EU]j#jwBq9[I$9Hҋ/K*5mBHI6}VI@MK PҼFNxcՐh@Gf}ED{qԦ_qR4/)_ݚȎKxէu%],qWn92#H6DX/ UeHhA##Ƨ-Ԋz:zܛ_3]yee&R'zmf@IwI k7oEc5ISNdqpTP BaW֞.:8xa+J?)|W^>s%6۔j9_;UZ9)* Yְ%ȒeYS DJES#IVCɥGSB+ 5q&@uA"|f*23[PP_CC ੎GL@ bM\tpz\(*A:F2XUi$jT6-i`Vmu;cju*I"G³ݘldzQĊ8`P[- =GKNPQ㣢MI4壋J,-+q.njMmc/:%A%q{KtLƀF8./è"\PGOXyvt^ݝY1?9XRmAKUPʉQL, B1b%=W6~`X#3 (Xa۶KSU%hFS+XX` H#K9+M4ζS5]=u;_6*~fVtmqFLrW)sKM_[SK,,7β{7(f\f#=)HZ"ލ}[m߭f t &PAM>Fx,=GSMJ 9 j:)"2aW('K4Xj+!ZJEONeiIWP"@pPj<^ⰣZ ⿗Sm\'ͶOK!OGA5^>.Ӱe"b%%<<244Ƌ+FL0xAm@M׍8>x燙N1d+rPQWRAD5y7%U"W[?ޱx,F[.b twIXA8Fx+B{Cr!VeW5?}ƬR=kBtM܃)g$ÉR`h#l ~%Xk-T\J,u Mb9=ollTC O͇|ێk}R[Wbl9e~ln8@f{~i,O:}w*\Zu^׾[mls~?{={\o~>^Ncv7_|j:u]MO|lC:=w6nO'Zb?=˟{{`Buxbx>]_xpu*sy|=ҟV?]pWQo o?ވ^ޱDI:X7#G~}[N+ ׷j~ۃ׸}/|C$y?CDu~]{yQ_m=^l?S޺] ߏ{~?G~:4xo}0O~զ:~]v;OXH~{c|A}?#?qov?[ޮO}?"U}o~8]xjaŽ`c(r8:iO!S,\HfRAOmb$VW(?L`SL3D]c&/.gO*K-VOK؋O+gVc3tƏ9oC}n1M^$,-%/ۃR~][cv?1dYZᛩ7d:N짓P9?ySM_ՖЩG\xb)(\Nm51-VSYl{~xӟhdWaHx%wxCQ[1_lޒRioI-E%\Q,9`ѕQbM6{P`S=7+R+c4; η.%O}qkEdstcCS- L*rH-mdmCYopO(t,T-i4νshHY$ h &NOSIzŕY%bjBGX2C4Ѽ7M w"4m_&(;4AMr{\x??k0^ERVGr<P87$?5O8LJ}{\o Q|a'V̤t V=AЋƽOz?tzv7V_TR/{/gm>*[~_ǿ~Gh<|\_ Xq]}7Şu[b&<皀GoH'U;޽twN_V\r~~4fE:ْ,6S?6yo}uo^Ũ?Ko{MۮAgdqo)z_n/7.Z~GuDL}Wz@yn熑)Wd{Pc9BM#DXXHßw~}1p8e?;jmoD>YW$7Oea z0#VZ|?79ћ2jz3qk|댤pMS^:a%$F%@c8ef چlHԗ#ǨgR 50k:I.3P̨|55EqR?osr4$@ 4s}N3y* qyydW c#|< "s}nޢ[DSt>&O#h[#-Fz{o9 ,-ɵ~fQ|ܘ!@/nN71VY Us~I'C־?~G?)-́'o~n!Zo"t__۞2'g^#qo 2w |7 ?$q*1GT\kS+[X6ϋ[N>d?N\yŸ[G>4[S8W xb.?k;Lu'WGdo\q`6?K}RzׄgxLy#RvN7~t$8?AoͿ}~޽?׆gAoI[-IOk21_uνc;:Ogfnm\ä6qځ:[;:OGfo W2_t~}hu}yv_x XB>&͇1>:rx/A7h;_pZMo~}eWu i?Ϯ_ı N%t ^z? P ׌,|^#+~S],mg~qS)7#~iGZd1"46+}[k>LXl?n:؅]}?QsM)_szD4{֡N#bjp?q +_OkpV8tUPb&?خEB?_s[9$?K~~ҧxs]G okr?]?§|u$z:F={8-@?*||:׈:G]V~?_}v' OS~ԧucqWi? cwqg8?=:1׼&?}UґEBwp!`3^o'Zkְ|:׆އ}ҏO3ڈu^?.SB~Ul ݇~cz58z?K Y0 `1 }{۲˪e?qUM+Hft]8 9.=Z1Zg^K<OBemoBzU:װPHk{RB؏ =|^ZE槭{2uV??S(K܃}=4׮^HE?o߫׆x|ԒJ~y_ۈ2@?t\[* }<[j&_ȿS'Ǿۅ8 om"6Mz|[O!I >,5׽z!Poͫ׾|WmVn@.>"ȯ^(&jkـS^~x|FܞK Z{ Xkր!k~?޽կ]X~/:) o67:ת:6HJoX|!H?Qؒl/"?aՇ]}/#Ń!noz]uM.yR^ֺJMKߺʢ[?Gqn/~eF]{{}zWh8PlT؋{s{z$~y_}jREؒo%{]x7"n}D\ ~,?o]{KH,?OO=}{Kkk-}=xP{okM~~z:ޯkk^~ש_>nnx ߛk׸žO׏}?E#Oӎ/zHty9oO߫Zum^sU[Ǜ\:ikXZ]{p'׺[}ΏpI}HkɃ_NōQ̊GC?{Pۊ!IG06nA}KlVNj_~c S??yᵌ5yKǨX-Gj߭T5d7mȱi֜0*ztXͤT@b%M+8:Y$5S’T=!iUa . TOxRdiHb34kr Ucaqf^װSFd}:uh4H DH. ?Ջ~Ƒ<jR xU϶G~T/?:}ac$׉8ި4:(Zͅ|4p? ?<{Ϗꀌ~Σ",,Eňb=$~m{p}o94\] M _=n?:_.+F ȌZ!jVMX<ҦIn}=c:E|+hYQ-?s}5JH+"{sf껡g3aD:H6?Od(X`XZl?{! C?c]s{\jRֿ'˥5?[pm{~OWF[.׷/?n}GӼ@?H?'SӋ~Ott}?n\]O"Ooqk큓ϪX m Ko=S[6NT4~?OGZ~ˤ˩~8[(p$\?f~z9/ڂ:BG^E<45+׽*E7<O݁T"{߁~^r->JuJׯ{['^X':z1kEZNWIԙ X<_r"1:u~Y qG=(SC,? :g$[&Qq{O1~]o52״B1k鬀@ ۏ3fϭ򓅹5#ߏUCT.#f-ErHrOo*qHWtg=j- A5f}6ry#A bкHy3$1(H AKDS$kƽ#,uh5_/yq5J36:Wc =SFf#I<[8}P@ %P~=l`WV?p'emE1x|*ݖ0[Q%G$5(ϖY;"RX[ͩ?Bjӯ?9K*>C:mϺ%tE&?.؍':9?? IU}bgE>_S^Oa~{}}/=xbߛ.~ߏP/Wux4rIF?zҊcǼpp o'ڄAӺA5hx?^^u?OsVўI\7 o+^z$Z~?[\[ьg@F}kǖ yOӥ׽qqj'}>_M+^ ۏQ?qN+?V{y'V*Zoz麀>޽?l4y6=z{\M,NUŽuZ׽.yQO˧8ׯ{S{E{Ÿ[ߏ[a:tIO/rhiA6ϺX֪{݌|>ظ*!Hv~I2!MU0vxYfxV 4_Fem1-Zgǣ7T䖩-+|ik(ឆJI1@$i Vk~qn}VHE[^u`c܍LR5\cVkYaHb@T8MO(6~.[k3k7gdے>a:jo=+P҅rRQG-7 #5~.FB O)p>yvKv/\n]]N)(`^]X\I|DR|=g:.,DwD*Yoʕ4IfYCX KqPi*䎖*{{^Ǖ^هҫJ`<:h7q+U3cIQS-TE1K#|tUIfITA9ȍUX-XDTT̐FA'4qE@Kw8#ʟ㧬TZ⥟k*qU:UHP䶸׺BXNA"M30R$If2TYI>͏JBP-tW#Jҋ < W>p?=4m\vmz8) 3&aI T{pR#E TBW(ڹ㣦6jQTˑyOy%H@p,0DQ)b8"k/r0Rj[MZulVE=+do+K$Z!b] #)qXyԠ)fS5Eq2䵴JA@8to<& (t3m>;wdecu%bd(q&UMC(QP<44B2vY(*Jȳ֑*]ғ2r!)t?`v\N0|>ϳMjȒЯ駄8e5E>x1Xj6cSlr'p|zFal> ^uJQ#MҦX\Ud笩!VbQ#@ J#7]1%MhJi G.Zg_[;gc6CCv+jz੪YRL^)yޕx.Ĕӟ8 /?%,hA/$b[Jhҿ $`z6,ZQDB#g76ܥlKB8W 6'Z'YBJi >Jm:dT*/F`}}x̍Қ*)pUX@zU>_/WuQb?{Ra=4%CWuU5TkRJ*}4!ӈᯚStՋ3q"4mu\g8"i@ <+zb[q=Py )5ˠ )U5k)cDs6":zz+UO8+ 𾺡-CƊp<ԝ6_ZnurjA*>jwv=cNj"J"*&W -KGqqsn㜬Uu2yjӊByxПϻfԠJT^>gΝVO#b+J|OK+bQ૿&6Y|h}ȥ,GA)SMURb`i!/GG(Au"DOOTT*q+2^8FQRoUQ!̼>k83@%/pQ:6겣#'2414( . bCsZQ^M$YEJ%(*e?JyZVJ ۫f'֮K#ɬ$pA{y02kk$t莎:Zz-㰺u,br]SSVSWK+kЍcoakpC~1cw|EDZW$}b_sf=]$THgK% HFwU?Ķa0{wnl|.Xb+HV$8:ifeUW;\&ר䤭70 #MZ\J$K][sgۢAdq4}:-WZkӏt۽Ljsx:l_"^ Co%B56&cJZ#S]WڞZ5  #>(&1&6Nwpop+>g)6NfoM|t28BƱ" x_kN(j*)DEoc_n8Q\wyӥ6~u0iレJ|܋bN"hqщttCj_n;MDA<"j%!}C_S05=ZQI~zW 53" 1Mx̩ZZeȦY[ Xn/+Wϐ:^8QμJZ?uo/2xT:v ^#>`~ެhGdRl62[Xpn6zi%Mf॥i#q뫕=55- "(Es/XRـSr9~5_,}EH"c -ǕyϽc6Ez?!8h;)Q[PEELJ-匄aP5dxcX m(3j*UqsM8qb}30UیUSry^VJsdX[pyj*'ܖ uȚ:BCd*y҉fN572k<ۛgS$^8"q]R0ơ $q<nXqIip6?~|C.t$Jg$f1=,1H AesI-\EE $B):K^׃`.7ҧFsZ!נ88HQNzt{I)*]HUc,HI Z9Tei O136>ޙiBHk_.i"'N=O?˧0ySV%*tKN3 nv~wCdgN:S+;Bݍiۻ=Y,Lu P³OQH UA %n*fi"-N-kihMSIRY޲Ӽ| Yhim:xҵ㊚So啛ILRuOgv||Q&X\Z*WINE,qȊKtX1`L̺<{.XJhB?hxׅ7-™WbՔvms<) O^B \-{b{q>lUrZx)18YZtrgSTӳ/eGgO4CM͵&z1oi<pi1  \$6t Sx.Injȇֈ?}඀aQ({s[܁Zuz??_|~5 /.m|i.?xoo9<ڴ~z漟x ^ rnx\COTab. ^~I7#q鏟^#e9~sϯW$sߛz^@ӓbEX@~XHXXu`+[FH*.uJuOHn%G@z~|bH$^?ÏchA6/׺OK&u\# ^ֿUؒW~=N>p?{ϽîHR_WA[޺]j-mo|n XiO:AB?ě\-~x~q}?Qk؟S,8q>׺nI7׋^_"?Cs]pE}_}h}ny7{q=hKO~ާژ?7ʲfaČH İU'ݙ j"z&U54RTSD:!IӀOY>–z,G 竴fRX~{'|r{)ʻifRT5G걹 ھ\>]=1tqk?=]eMſWomfo\QiKnX5cHVj:o5%D?@VUmJIV#\^~ (vG@7{7X؆76O?^/o{>u]xR_YcdT}"}NZTj^}qlm71o4g!&F&IoO/8 #~}/ʽRAK~>Oudk5\6~PqoqH"v?7'~"ז\.9E?{8MTo{x?=HwzО 04ߛoxܟ$?_z w=x1=PAQ?bSY$i[|`~EA?fc8MY=_777,I^4x/˯ǓoQx~qO[,D<~~ǺPzc_Yopoɹ`|1~ lx5^9uc}i`PFO\'Sӑ3}cp'h_|-QZTXQ}Cua~c:o=TwHa _5B !MyCjb9{4op׳O{|z˴OysT5W'־Cy.b?M?okO|U ][ c/h[{4RI:VC?`8>.s|=NyƸ7 xGW{t xDeIIY/m?_jgMŗ`W=r]!;K{n<$s#=-o/߾G uLp+^-|%f lě!?grqGf܄n5-h:Tܛlۨivj^p;31ߟs}eO-%h#Ϳ+taƟulp𯛘rH~z>^O)tu㴱OLֈ{w}<0E(:_&==Է-{TozTՌ 1qODGJ j'O&S:׿ض!{ߩoM9x`~]T\?Վ %UW+(AH~νgRSy>!ܟx3`Z9?g^7g]N9N#T޼%K:Ձ׿?_Ǿ/Xg=r]NE%?懼q䑼0BGsmjY^{6ӫ J^Yp|J-;pF3mF+e]WX}J \G fI\ 3Ut]f5*u(ank@JG&8\ /:#*vcCr}q!VX܁GMJM]j|xY_˭,r?}@b׼J/?>MUPȒB@ؓf?2!+]x=rl: $܈E{+:~dJ!NX)2qpmoN(]2F&DW:͸rӂA-ҧA$[UCt@?m%>}NaYUqo>׾_qAqM%`[>fSq}?'m݄[O'>?ɛ_#JZui.(p8o =Tu=2qK{kRɐ Ji+ա:PǘVm$qUV# Dqʟ0l!C!` 7'-~{s|<:ċ{lMǷZne 8o[[=&=l~P\2>y_u|}CZǛ\ǽ?T?{pX@_O߇V^{-D_.l@iï{\#W_^@77ߏs^ou P֕g{~~Tanx>s׺\^qt q~zYl{ϼ}<:oz]{XK7:\ŌبmMϦ[XW-l5ZI#~?߉ѥIqbmY&1LoE"?CܿAV!ugI}[omSS":.[yIoװῩKfGJ#4W#XćDhoQYͽfH"up~11?P yc]tg^@1:éecb#đթtY '-ůTKV\ޙONUk R*)1/IJGH<.Y$yEH_74щ/N4^ew LQtiPv-OR;$X@ְQs `|z _S"!g>WHI tߋkDhY‹7k}~o{X/qM|}o˦i^MWrJ":]AT}rXw`,X>E1&5+Ƅю՛?z4 #TELӃQ3PuG~=u`ޛM%rMp>xsͲl@8=_?;bh7Zq]@ٻ5f~Γ|7]^st}_~}%@$k%~{Or,T@/?ˡΈ)}W??=kY%>ON:RS[H6⟏A95W.>E7yւ~{ 7=ֽyqtÞV7\?znƸ?g׽}ZPX?C{ޒAXߘV&^H_z~Ϸ&?/uv#o jaV65jeLT y^`,KȋEϲ]JSD"%J^kiqjt=e{<.1Q.xrFVҬ:mzk  2˳:#Km)s^x-DT}:E8X<@S\P#FX_T3wΛƿkwF>ME0֩]E]|U,gq@xSJRrGBUp~3غJ zj^fSő1<,}=MtM邒&6 +d.\|7qP@lܱ|k>R[f pn9i05jȱG"΀sJ:탆VTTUaqxmCS,T-Ly2 F+CDTI1^@I T~c:%Aw3<|8R>|:)(;7;Qcح7#5$jfI bHYRFvuVx2Q>&ce Jxe ݤK7-GIāN>OOL5եOcˢEYޛCvu{'E>l̔ehj?kG%=*:R27TNLܴbS.b % j^FVU-,o ?AV\-&1Q#R|iٟMHe#2*YmC.w-u-=5j,$PRʕ9UMFյw1tQ1vHZM7T`OK6B ZgҖ"(bŔ-JN• kĊ 5,t04 A&-Sҽ";z{2=-faym燣\18_jʳ4J$ARZiKOCQ!jYl@/klI8")i_.UkS_*PS<}:$gVfjpsOIj(p喖+z)j䬎,ȪH>TCq4tu-QBH{*-{'FN5=RPC #Jnu8榖hXilS$|Z-QKoƮ,4<6Ǜ(P4?ټCġQ_.?VkOO>{>%T(r8L~xh~"P&=lHjJ_M{SC_%%) =$SM y}juڰk4k"jvF@Wh-^9AϢg(ӗG6V)``{"-.HUcsR@%'E=etA*kgbPGBXUUWN<}4?0=cVz8x  *׽)iB̢Ve22hFg ;~'x5#Cl_Ftks=|P1O_:2Eq~yle5U=lrtq1Z*<ʐyKXLз儈qu9+T-Q(ب$5Q϶ R8gO (VM0qx{p=pWE4t/8kzmGEk(b}j3QKQIB3Iz.<EQQrǞI<2_6]3rFxW^} }w>8oueM&nYTtSy Ȣ1VJGO(>C6%e @fyKYac-䍪uNiO_珟J (4>\~Ò7krnÄV95W)LT8/hkdeV%#@{y ^IbDEs*&쳸I5iƒ#}6OcǠ?V6;>ʥ ɺjQ}č#RT(,T; -5(TKH N̜rcN&|U4(sƃz'p5<8PW,V򂔫>]^8Wu!->iddjżҸFJ52G=vNյ/C&X1-1cS]EmO]+1fie2Tf+"cKn [Brdn?HkU_-Ҡp}}"d|FvARC;";>lON"YjgZFOPc3ȈqCyަ;TW׺'f:Zic>,=xhh>>}\ܩk;G=+q'w3'=Oc.ꝗK?A6/C=|{ H4Z ]ZSKOMEHh9,3~sfGF}1#h9qP֟UJ\ +[?&V+B icM=GHM>!hm48XhLȉU-ca^IyiDzQ)ȹ rNcRm`[9MLOǕGοoK;Vj8ԨZ> *S- 7ej ZC^CINLb+^[mn fWTc{Q'b,M=7zTҿzϏ?A>jG:(-6~?9\-$'o 鄖*U˸6,ړ<(pg=Tte_Ȳ3idC<yzUKy՘p<2Z '95[KT_cN~EM#Hh%HET,dd(֞R]pT6"D\mŽS[P8LפE 㑊8c=vtĊ)hv-uWZ皇j*A4ϼ@֩=i S2vF{}C! $p- Qɭuk6*Gj GcOۈQX)BDŸF#9Щ]Is6j8*j%)UEPRs}oQ' `#NJO08^2UejnH5jw΢O 06') X6P*,Gˇқ+m"?Y'_~'[vfLR*Sf-+ྪ饄Qp7D)z|RPTE3`$u&*iN8ʞΝQMt8ˢr9)?57&g'U^$E×$4ebt$1-,=Nj2Jjr+:S<)R?>pPPs|H&H\NOF#m68S,uVԛY*RDԵb2VI* #RX]dR[H(ܝ f76Қx0sSa)^~3R h66GeP RSs9'VMV'".͍$}Gtd{>mўLPV(P*X$qLWLT2ѷ%&*C X +Yltl}%SQΖS^9j'O#&<1mMu^&`oٚ͘(Yj*Q~LtI3OOy5 pЬQóZ06匊-aI`/.xZ&+Ppgjf%M8tj#]&Z* oe-2OLGXTƀ>K]_6X**"G&:K-pl̤~ -6s踥)ϣiZ)\gWO ?x?öGmFuST DѴnZJz} [0.QUMS$8'VHA5tB..}vE0>>UYss,eT?:hݿf;9Pa< ,iK%@msP0muaa)Zb:XAFFB7jQKc*()R+O:ktcjq1{g;kCQS yn*+'xjmZ< ;A}$rm}k6+Z}?De)rG=?.&ޕluWST 1V0`52/*rVUSQ]Q<*CQrRZE\}b'5&<|^fjmm~*: 8ÑUf(i5^I7 N{"Z o5@ar?PĒo\b+3zIjT&G'E;=Es^u눦ܵ[+I d4YVHg!Z;tSb4rRf-h.jupfU:$6h<i!NHjO zYzK{Γy fdC$,n&9<"juCLPbUUG{|xݪbɭ;TȂ2EerӖkW@I&p~ۭ+fVMQOR.i4O$vFowoQm,$z,4+Gv=16?5BYh$O GҤ5A8FB~](d[R*?^wgX}粺6]&)snY9jɼp8ը>tʊϩ2~9fZNTR+ Y"\+pÇOyV#h{>|P5 %N2+_.ޠ_K$Q%{q c<7nAMso,!͉jzij9fVf`--!8pH'4Wꚷs4ǭ?OŬV܄qWw'mG4mQɘ&_LRPKs+7^&7-PCM2D2v8Pi?*T.ݩSVQԕ"qi'w:F/id~V]֖zz,rZJڌewȣZ姨Vx ol.mG-.ہ䣆%X c1"*>9Dm*[gFTb3,e"5SP=G`7ؽۏݍvR:=WP`nI(j(jQ\*CCS[=̧7 X\/l{܃4Z<_p-@bFAG_uH\/H?GJ<>oy8 kPPa^3?{:?o=ڔ:W{-ozmƫ&Oש׽&_X~?>íNnS9 6Ua~XAmuWnooϾ rxEȹmoꔯ^l Ə>={߉VG>>S?[ߩ׀݀@\䋏ߺ^? I ^=u|-6Op9"׺y~X[?ǽ>pځ?_ZÂI?Oz͇ШTV́-4rH&Xng!Pµ+]y-iN'?wK⁕Kp ]932  R칝OTh%ZE$Co*7 ïxXԟU iU|D<:EMŨN~{IZvmڑ52' fhqWʽlc@~`QOO<{iyeo=eQԇf@Ͽ iPzGƘ4^i%O+qxW.ٵUMڒL3 ۏ9>m$M>ΛYsA$djzu`}Ϻ;.jD$\d)=h?އ^9*EyO6z8MߵHsQ]MS}-V:zu+Mi?fz?AQbyZy(sk`c 8X.kmZ5GۃCn5|^25J19YiT䒿ֹ4bHJ$b=*bEҀ86p>qъ1H*r:6aԆHWM,4Jʭſ=8GM-*u%Jٔjoil?wM.\.b&VjgXpf/l`1G\_>R!]2d2*VhY굉[tzk>1y 2Vִҫo;ہ?}٘5x_&9w6۵BI?_`( :6!~IԼ϶ #X^ /T4?<lF2.9IO'-6rx{ZLCunlI+|smuc\tG_H![K[ݓ1-ҿco,*e>9vXGE^D +t*yg>qJL~CpFI-cPumȑ7uT ي`ߗY#7)U+a}?OXX.֑6[oIREQ{dXϙ_/ՄsZp:aIAh)(;TӵX {ʁ<R3 ON(€ ?F}}Œ!eԀ:i^,#caT<[#hJuk禌7[DdRO뿹,*i{;KDcF% R=uƃ2z'އ]VTsa!`ey#FfnlrߎƤa'hxjއ\¢ ~mTd9ƈ PZ{2[2z֩4Կ$ŋpG?%ٱۗ6 }o{X"fpF~ƛ=}?}5ݓ{m-]n )5[[}Ï'^}T5-Gi׵co~k=-gġj&aP}\dqr@#?\~b?Q^}gn'K'?_ߐm{ߴqVrxx乞?Ǩh fo1x>1~`0f}PRcb?!c7ʗwuimFJqa7k?uoAL?1v^}_udbU9&ד=*^W\?Ϭ)r$Q>7_d~Iqk9b7U?wj{RuVEPAÓ؏~={ǐEG;3pT3 -vۍcz׍'m39H;p TqA[ߌI4~@{e?ּxce1k,8ӛuPg׌ykVWlB)ҟ.yax0P>^v<_>E׹%%͍{т3N?ڿa(93~=;qxqyga`4~ED%z\J?~uEr<5=X|k0WL9Qz5Wٷ|R"nj-!MϺdf-@Eq2Ya>omsxzuxd{-E5 & X?~n)}Dn<^!wsbe\I"_W?V&_(urpiuD?ݟ_ϐ{wJnh z"bpO<^ߎ}„O||޽hx};|#W h8t6?ḥ3?gG (cHܬI$O`En>=@uW׻YJ_-=p"2 oo{2F6^Mj 6P^-J]:%g~:OO>>]viYt\B(6_o>!p?:e쎺2߼#s;#;& [!Wc ?z妓;'O}ƛ9YBU 4qR ^2MCE<o\Ec5}]3%X0l\1~zH"`Jyh^,2л8_mo>yby"-7Z/{֝;\uCy4Taudh[*ͪ[{z8\t#n?}23b4r@$Ϸ+NzzUTcgXOv#\jWS>IGdF/>y JSu9ܧ`^йG"h7=9R$h=N.5ןaK]T #^ڰc@}y9'I28)]'mk{q]kM:0c${*:G^K׽ZE_#>_׏^&<7^ߏZ㞽n@ A}wZuăPbCZڥhiMƖ}{%[njos<#g{ %fm,=#@_5>E^׽< (>jo?}֝n{`>?5_ ?: ԺxaŅzrOԛ{{ZT^ܓk׸?O|qk) ~}lǏ$`X{:~q!TO?{^<g3o~=7zߎ-{y@1~"P?QG[,,qYoo}{8G?O~Z^rCjY~m؞?~}Zۏ| 6 #{Z[s:_!bmfnO}1nl2c7C>ía 8'?oϿu~GG}@<{[GǾw6,8qljHyǞ7oaW]}M)~&Ok޺_| [^܀ԭz]{&!'?~XS[ۄ\MXO_<\|z?:o!"3`o{7krWAэHGA?ͽYMl!3SE >mUL *ut(WzG@hOamm1穊66oǓdj)[CUv`I\qHn4C=GEzH) "UqbWh$PI<`@OOCr̚A]EϨ?֬HϦia(,tb)+I@V7MN,jUV8ƃOhS&jOW)abDn o#0{ē{{η U1ӟma¼E)?y<#K1[ܽulV3x\B~IBb}3ףp'46azbRt<eU!Ξȳ}6٥Auvx[=LeH}77h+`Iol|Qu~96qgM0<qg"=so5i?LJn׿POR*wMZmCГx٫q]F3Ț8G%N r XrZg~qN9#ekyi?~K8FHB]6=>VolDjm:X!ml~c{r..>c~uB}{] A%9iS׽Ɲ=men,M?>Gtitܢ(H~Ro_u׽MÐxcLt9M2 >ħz%mjܓѩ%Ԫ0!VG!P!, t ՚(\ Tqex2x-<#28ًuoZ|v:]$4Ųybj*@f-T4<8qK^I P(*)JmG'Wu.lMU뉩9J趶۔G#H!GVմkW4RU5]JFn@cj݃y͇[dEq`;Q,39,RT0(ա垽wptL>FQphk 3_M|}۫ou4[61'&s9k9%tĴ@.Փd`" -%HװJn]~Iɾ3PY*<Tj@p0-Ƽ5İoiU(:@MX4:W9O˼ihrM߲{m|`GMI@ٜ΃q}K_>"6(kFVD䒁 P]+OO )jRB|2TcV0d#S3^W%#Y,KMp)Sۿv^KtSU5*/kSbʡBEY)y/$yL,ZxuH掚8,7{\)@<ޯ |ϗLp葀__|gr}58 ^= LTR,,U63Y3rw*=rCkQe-`x:d|xz <1_Zz?/ G(1aVScUU꧆Ix}5 +4#xiRxd,P)@>7eg$,\>GxkBicMp%h߄P~TEnl|(k6kpd'i$*L"t2-"Dgiڹ+祅Ƭ\-=dU3Yy4bKi>$Eci>/Yk3MkQ\סgykrSmc͆E-FNH-/ޘlR>VXR(( Q( krt~[o{];` 7CJ^^~}حq隞9/UӸeyQW3M hbI\Ⱥ}1@B /O*dFY"P76}E1N4NIϬsceydjXkZ!zqEVJ8>uM\iaCO= ~o !|? S>i'gtX|Em]0W&(QަQC)ekDSʁItS`7r_ulBӊ0(| pEiSc*%y+NAHj4 ̂V7CTI-UPJ:ERy%TY"Ny@Z 4PJ~˅:/)u=I>Tc_V+gfsEJ%%;y*Yj&U XeK jϕZOIUH!-O/s[y})CV Eneό id}uɃz\LyQh'\T\& ]}JcJezK%Bk0낕q]a:G[WS\xISQ\TPL=;2.SX\~} ,3}͵0KS@({ƈ%#RO-/ O%%8uC$jڣ!DǂN.h(LWQGҾ |[+D֧Y#'])Z+{'hm6*I/WSIEQ[,>ee/J/`ISTtL%DCWP(H#P[Z$S3_2οs$UK zm;&¹Z1ΨEO(bѬ*ubL~(Ґӱe2Ta-} ,h`x p)Pb/Oulf[#ox_ldε,$PEl`#ƪdRO*#E5mM1ĭ[$}YƎ&se5cˎxZ8fS+(pԢfe jnŊ˩#㣗LLSCH#6Q1"G,hDW xSҵA~TbGڻrxv.C=[X*dy+r^IepC$b=jXq'-ÖF㨣<-Ncb&tAq{āvYY܍EPU-VJK(`\O)ii`⨎!@^RH۠i'q}!4@887W3y~מ*y4Q=dqr5XM|VzFxTZ9m^L-@j<~#$ݚE'p[:Ju.J3Y*O[fƲR@i:@v H C+ 4dBxFB^cunlGIY:$zu*Ii=1\gT*v?vƆUi $D85l4_ )fy&+2FȪ*EC[\kHUI1tgC.ڊ2Cbgiq8<faJji`%H(b )4Bʞc:Pj^HEXzen1y?oTU~\p'k1MYٛJ|-s,+rSPlB&0ᤨ|F"J=EQv&齳Oz;𛮮dQd=6cOOVKC<(]G&GU{E)5\bFGy"[kX \Jϐvh^4k>5Sʀ\F?mHO>:Yڔ[$o3G<9YBhL2FcI*32X.${qb@="s\0s-3F2Hrt LB3C§OD7R1Q_*|gm*mf=ӌ9D)Nm[&u< L;ےKk2SӵM)V'd&щ$v&Gm "ߐ} jO@NH W z|V3)7nsUVχ6jjD:*xBJn &\[Qࣁc*$ye4``Do,-{o!%K ^)zbZN}8֛; ~M]j˷ڇR>B0ט@yY͂|j!</ƀ'hqԭr{ݤStqzP:^(P<4BS|(/h9^z8<5 Td ӨH"&bAOm  tqRSR s!SC s!-L(~].|~uuci:o-We0y䆶J٤GLtO+24b9324Sx}T%^N\M>"NWbDN^IHaZx1KWM4HgBM{&q?kR;=xߜmɞ۾~|6ΦY-uojVTZ%,*f[+zޛsNvZkCbOVUg96 ڛړ` /h THcA^gW}A`mQJy+j ^M-#ЙJV,ۋ}5T%48hnI5,nөpBJ&TTuK SE+#Wǰp؅WK~8!w3iVxjjQ6hȚM*(sU5X %H %oS"Ⱥ*H篿F|NWï_U:4\ْکGUR8Lfwʍ7ny*JS#SI9u0y D˪'L!("h1֣ԝ ܔy5JňcdjiXJLl3RKvx6 D.[NkO(P8grD|nb,n;'YK~ .%4f4SGKK(I dbiQT2+/qa'VhX%#uF#W' }?ꡕy}A_ކ2kzu0a !?:?8<{v9Ž> "{u)!{X$}-~mx^1vH-Mf\6'`>{u)ᅉO}xR}v97}m^rlFZ^ ؏J?_<^_ƃϭu߼Fm.-ſ^Po^1 xfZqMiTÖ?ou+uor.>A{z'rE@~>^{߯#M\+|zk׿on?u}rH߫^s^.ޛ)7r?U]{sQuI-`?$A߫[ۋSJqO Z_z'ŻSޚ*xF$D<~8ܷ(մ$bO'ݼ>.:¹SȂT~1iwiTG3XJz顨eK[ \pk}Őw-WRFAhB N2dIUbu ]]Iws' I)Z&C1<;Ȩsc?w{ aR*SHCLd5F![S?O: Nߪiؼ/.jIH/ɺ"Qcu.HĊ%FGahэ#Pl'x^U7MU[k]ݹRmsy7J+us@IB\?N-JĜS?=:NI5^YLq`<(r9[i<}}Ŕ&xXQYB$ՉR<{UE:\$ ׂ#a#{(=L9[o5V$O }},ָ?[އZ:ǥΛ ^GА?=ఙ=ӒZdiLKH⾢>_SJ!?uW:g;S>k3TiʣNY6Pot+S4%%ĥ8SoǶ1 1嚞h//>:9Kz\TRG9"CƟbǖPm_eU E0:<}M?b?dt=Txϥ~@o϶CɹPmFď׻ Tu_1tभ0~[qoK5o?wcN=KF6?ٮA*YſR4vHq&>y}UNzzȭfr8X^Ñ'}j*_ɱ}E{Nì܎@$<`.?A&S1F]ndR>opf>cٟQv$惬P(comR7t`t?]ujV YxV<!N$6n/6{BJz]xqĶC?p<ڃuX>c,Q.K[=IQCǭ׮&H :͂?ۍc&?N+>TrR=_/+׵gw_[uzC!qo7q?Ϯ\`A4(ܕI`G {jDq{@[{c U5X}?#}_'LwO\u9{E񕶁V>˭ ~=sH!҄2Ob}A$SǮ\oox K@%sӟ~<1ˮ1CW67ϸ3+0s??q>}9H8", כ_}hǨ nu+o{N=wq 50e?@=S"56 }=W{?^N rB\C. \҅=c$qH>Cas}l.~ ސTq:~דitPC{Af?]]y,ob}h-$??`ӯ\'q,GH+q%D0 Op/k?}?*۝4YKn41_qm`%JRRn58Ս>f`8qԪ_oydW6Kďy#qnOͿ@z*P+jc:UAMLȿԒ6~=?;X1N bQ/@<?/eOH=?>`砿~Ó`U2nS.ղi*0S*/b;qGAgw"ݿ*ܓn&V~]Yb/1zwOeQR>5ewb%I4eU{XンuѓuG)Z$%,žhtF% [@;eYP%uA_Yd[e\FztCȑ,z!Yd7q+(]&/Z-r֊JI!]EA{ko5SZP*֥ٝ­(SV+ˣlVi3{qw"fa%5Qr^+mnohkMdL+53DrQx%VI#`nQm,)?O*܍HA dyusKUA"ذ>Щ[mžw PЁ0_ZէQ稦+`MrߍTbqANXn(T[\UfWӱ3@c3tinʚZ܋P#45o2 1bQ`n})n&C7}Nj7dajwtTDu>E:eKU0<_Ey25麳OӃqm"@:2GI 2h<ٕ<AT W*A(E .k3!ב։fźRŚ*w:bU?cw^bP ""~ed125}$x-Ոn?OǿSl1D5($Eu?}G.؋m:67}yǃ?{׽@?@?ڠC A::#IXcJ޽`H9-܇W#{5ΐY>[ߎ@k^ၶarx?n uzre1~~9<}/:^/}_,~oǏ~zO򩸰!kOD]X[aQr𷽞׿ϼuE#yuNHk׫N?O~1`H?׃^^an?_> 0үIvrpu׿_M:c7m6^NN*?ߔG䅱?noߺ<}H́B/{`Ok{=XyNGoŹQo{Z}. v_{׺D ?mƺcpn. n}׺`ܞ,_<O }={޽^K+]jQ}~{^^AȽ$:?* 䪲ߞ9>׺\& Zx~z>n*Iqß[_oV_XHobVkeN"'rۀ)ݦmjy q~=i]?ߑ l@#=7vWGseAF77𱱲b!6$\ۛ:Z95FP2\ /p@ůo6dRkN!3zQI%2LKA^bl<$$O*Ubu.u_P[ٜl\?g+\:OTO4-Mgh%y*ڊIQ _Ts(ͩC1PPq6OB8Ϗ.uTH|  `&Ɩ Gֽq3? pl9>X%kLqWzY,bX7,OeFu$ (@aqr?jթ9=ZN|k*f!hEJt*&RGk?M#Oǽ_SE3E{c.X2򥉳6_OYUF/}/ Oz)?/uQ!S,WU786?QT0 0o콪0Acҝ]?Y}&fEY.QgO+j?GKl5$X ~_?eUY|FJVBz8#2|ێ*GQjt`ic` @{{3oY_֙{'n@?:)AP.:wYy^#~zu]Ȭ6$ܛ?6m)X]>R9fHA7?pz-zG+7vMSb5f~!Zq~H{$+sr-suWwYOu܁a`8=ä::ŁUT17}du:ߋzu{ H^}l:*zC~nOo{a 6#UV:9Ï̉f~/_u9ts`oFZ"lhck\q#Mc*~%LcLW{#ހfH t:zOV%Z(Չq`o&~G6cs8W 1@۟.~EʎOQ⢝.vM#Um"l8ht 33x VkX~CP^&fd1qAu%hd&X)Mtv4Df#Q< rHH E)ц'~)t=8zź*lzs"2HŸ{VÝLGm{9ξ]H -:|p$P ہuI6㦕?rʚ}Y,|{j3-ډز<>\G}=M9_Ǥ^u?,EߋdWT9oqȹ??gh @x%֠$-76ېkuh'7 o8F i[L(@"'uyQ6<CD=r$Z?_liv~{/ކ?}s׽aq/GK:mYa{{vt^@lJ2?_})׽Dse?ݔx`H?aթ׽+!G[{| [.,~u&z̷ʎI?~?.+5ͅϻxueǗ^IJ3X*و䭀ߞEtՈ^r :ltW/9w$⪥japPKOWu`Op!(A?ֿgOkx*X>|)kmź"[Z\!Yh!*y-dr԰XH%Q\vnb%AdtU ʲlzXkۤbX`ZbLoBIEqˉX8d:})SNӪZ{EX^SC->s3xDT0Q4Z:>gϤH#N&zϩbF[9l+WCؘrVn G6fcP d8MXz*n*^iձaGz&uyDViLFVVp,/pj(8qc+1j S^[`m7b|Wvsk>؊a!vו)8&]M6;=5,p5UCR}u)1H @fizSx]xF+<}=˷wPn=]4d1) X)$jRDUt*f*[3LɔI4Pn3'YY@3__oMD:~ 1}OMĸ*8:dz`QY:$s$d44 GrzC: "f{$)[H^Y)/ɸf9F}m,n\R>޸X*#V!Ql{ XM1xE,꒴dvm /s@3RPOC4uȷF.A}[in퍫j*Tj P>u??]Š@ 9ɥ)_6u69}iY{fj522Ә,I1ڪ܄k֝J9!6p~$цwÀ/Bu5x@{ӆ?Ae5^ݴ~Ke*5,rMFyBPTGFRW!%-*Mh,$(?Ino.վb?LF>4s}:A͖W&>:Mݻj MT Ma ܐTy dףWXR* R?`fNj5]ZlNaQř3SVE(dF^؞dG2?ˠ!?Vb׵r@ ,OƠIE??Mp"sL* ⎩1)M F#0 HbKWJjbHF7) 5[_:*e,HN GB9|*G:91ڦ %Aq1)উ(`YPK.nj),YRNO}+q:c&T>_AhOk)q**eRM.4BBk$6Ъ`bRX!Z.i5&i#%K#RRE(ă?m8x%8a"!L죤 Oe堢*"8z q$Hgdc4iǐ$1T3QDDKks:bN=(Q<2*- 49k ;Fc2F?~OJ5Nr? !fW* i%P%r YDBhhǣI<3xvNoh5RT}E) 0?5_//ֿޚ!dtO9$@kuY#4.6#h\b0X_HD8*/fk.8aBKs⾦X|tՍ{#ud(תfHWV?WsW$s'['r RUb$4HԕNu+]tI wWk_$yY>>^|:!ŷwhϗs}6c @GzeU&JI{è Cm&O'9Zk4驐_LpO GkMK >9e*L@>dߟFMÏ n bu@6_p_%IH39zUnC#I:IYީ u)Z3bt\s#dBIUCfq o*4: |z$]ɱ:!ziq{K+jVZLr02k ]]:} EPOCY+$dYmrtal׸ }*Ms|G, J|n}wV>/랽X|)G]ъdF3f {6!n TPLBTjdcG G-\+EɠZ:3Ě,}5=955Vd}n*ኡ HڐQFQ D# 9pTLjv&#PBap64(!QC矙tА~~_A9xaZ[ul cjt\he5,L%EH%G] XUڛ![,S*Y%9bKKgj7LMB_݆h剄&*,@a$ZGQ=_bM3!T%hxSFs}iێoᵹ tmVT 17VUM:')>uQ,Zfǃ=MUOi.cd{甎sTec H@ OV n@X34t-ZyqE=>@ 4t qN4'Kbzy(Vl=jJ$L~j.ardvܹJK.܎Q߮$c8W Iά paRuWfoz?hu>ODIcLΟlPͮ=W#G):dq:y|%wHz&?yKfRyic@H>KQWz\퍃M#%CJ#gH<΋L;U g\4MݐVTVP*F>DHi\ҩb͠ԏj&dn\3lSg*5_R f E@{FH<!iN$ ̵<Z`w| !j,*NϪ(KRiiEp^VxBHlf:{AEM<2) :Ћ)y`|[fTd18 t`{G|U5x齪 zmJYT4LR%܃dc 横4t%F:J;&-$)u%[P>JSE@kW=?5z8 ?:tJƟIE~靥[J[bB^Zy_j5Ɍh!Eg.eZ;RH8u1 qt8b_vBZYiv[o*-=M5efV͡n:rVURmt4&k^yݣm^QQbK[FRjhT?xuX҃@knl*<2wNuUTRx^!5Y"E V< QXb2_Hǀn9[ʮuli8=C@FO~ʜF+$tG%Kzi)U:ҤPUL(4%P즬\B=Ie6Uin;h]ZFT*:nLbBl'aRm|xߕK:@+jwJqW2U?TVMuH_i.|=>+"䬞!&Z< ̰SḆ(A]mseL `W>mZ_&G a"ܛ}@Q);$'Mץw/NfT5 5iOLxԙ; vR,‚j+-rzΏTmHH\R)QJJW!_t^ Y|~%WQ;AL0ҸĐcyV. "5*];ٝS]&j5K}Ч FB@b}M´>3t\~*c.P"\^5;VT,eA:^I[PJ/G6s-ur>VIX>CaXtΡB*3*|mϺh&)GCֱb9eՎ8u'H<:߁ ƨ J#`~ց"ЋI?PT]n,?o^e+^]\mʋ)z@?RO@'=PoxM]Gajq~p}sk.}ʽ{k}G>Q~ l@~Oϼjx7 9 6<4=x@M\ nkרO]zXϵAYUJH`T_?_XRߟ|凪roM9^ B޺^8Ԯ/}u1Fobt}/~u}b\m_v2H |3.y{W/MZAu>хS}JAP~i`Yl&/~_vi})s@b$H?x޽{ijd_K1wOXĀHs0ON(j?JfV,p4e*Ǭ:lH6z$yUԕuqGߨ>{JŊ"@O*G -ǹe4QJf$6?T7pzN['ݬ>Oxf;T"ސP0 :Hci H,,F{/˫?^x47HcHW?Qg.[uѓpNl~q}B$Fꤞ xbj$bMm~q/¢4sp(*F#<>1bYc6q{f?f>eҧ9($*<@9#o) mT)_4r1:Isny>xtӜoڀ5N7OoyȫpPc,BQQ$my"oiդ72IThSlldf?7`ܽ& OU׺KM 2_P7v:x=X[0Mx~z'^GQK 96#{O~RNz֪uȷ GQPaȵ뎏G,XVZ\zN[knf( PW=뗤b\9$.n5o?>o]H}I=kpeZr?xc5F: }㼖7nTL5i0y?Wk؟'k=h*P޻m{.c1 ?݅GV<î7M[=B[|N?Ց .7he /}/ZaJgNA_)ei1 ޒu l~.WIrEO}C) gYgcsdӫ^]x?|4K%Qc%něRu|^ƴOh?(3/܁l??=0snok2,~A?8_.sM"A~0_'<^s@{pcx׮o>igg,Lɷ6XqoǺz2~αk>c ėP<,Ć-WDQLϬ-~G?Oq=$.sy޶|=E*¡^? udz_<:ȿo,׽iYycksn}<:MjRۆbF?ָj߁ǼmN*?~ֈׄMqqBZfjD^>}Њޛ"u#ZyH~ޒcbC;06 5t4$#X?[qq;vOqlU)o F?CHbkISwA3qztTVyJ(28(`iD+x\$/8ukhᯩ]SGDQr<6ܛ{N-9-Q?HH/@$WA*-{`occ_xCkfj7nRLt {E#NK@VH׏ b"t'xZ4[^X|(QjpˠFLv;tv6Cpr5-` )DD$k:u"C~Vȋ;y^ME5Nɚu,$RxCsO#W0G.aϢLMj{N8|htݸN54ʩY+)PޣSZ%HYdz%/cFݛUO<Ldx!O?lΌ:P:tY@ _ߤ[UB+b+%C,Q{$!2:zk eX#3g-cNFNB[U_eI?vF*ɝcM㔓3yM neER+£Y":h0#{'Pk|4)2 d 4_mZG Lt$q6O7=]G'GLnM[W[pЫ PI9}9ĺG8bf϶(eCKK,3+J'gp z &81HB,Ej|}v>N\\xcM6Bvkj ZPR@A4-f|[Ŵ>@|5tqPvvCIS]Dy#Gg ؠR uI,l^= T07ct'ykNXƁSUlR>AΡ_#<הU8kjtUy^H_%4u;r ?kNrnC YjcQ=|L eKyX5)[n!+@`pt_uiq= ]5T h y˥oS퍷'gb#SGsw2ѻ~ڪVm K\67$3oDz(X 94a#s yVmold1u4oR8W"]u?[̦b`y*^z,と?^?v4@HȂF o~_l:PpmUc1d@؛ _O:h˞7<*-v+8ʛ@oϻIAD,ӂ`V :M^}}%ꢥnx7(lHvŶ9ccoŏֽl[I=3I鼇p` uo{o[]wDdIjɵ[>Κ{&aFV5T[oBŸphnf:w`|V Y?_PI$)=]~> KESzvT5Uh[od;2g8HH@3)Nz A5zPW?n(:?:+{;փS=!)I t~i?Rʞ)䂫&mzz9$y?6_~?7^Goh> .UO ]K},9{k?Ŵ7^2!)p؜ ʀ@>K?׍[G ?ȿ_}Mp/'n,?-yٙ8_~ u,gL_qd8kXԿſ߄_O캁!8?7ű՜+Q}L?߼T%koozX}Ox ߰Zqϼ+h3ZNׄx+(C6+2h-}?Fx}>gquz_陸[ё?2FR(uWdST3SWtQ?=eG4 N<.*t$F2!>5]@Ss{sMNx<-*ʐ?]kȌ"{_E^&ۄ#Ԧ[i6zRu {xI E.SN&ت-O!䯽/7` ^f ~y<{YiZvَfoo:G=-N]*u#707>CYUSN2nx[ӂ?&il^ZyRO,BGS\ːEHH%`AtV} 2>OOӄ֣̳jt @WXIaeUr@L@Am?Q_G5|.5xP֑TD"u:Qŭ{?P:}Y:c_I-~t@zh!Y&`< bUF7ai5qaʺ1byb52 T0a{աҵ=HgLVSU4j77+A` ~~}]_\mn_i uũjM%ʧIT`tH4%FE<v_:~άƒz'5#[BI`6 Xzx<9َ,Ib/}ET}%nAFwe+f PX Wߑ+ٮc$ []+?pQ.=r?ǣ.~K ȜfW$"Bx,*B{ ʶ,rn}>ΧWˡuczvm+OFXvaQA9]1pIB}~G:Ob6ָK P2F徤Y!~|~ހ~px_hZIXߞ9#o?_>(^R)̿iqWx M}X?;˧HkTK5_?_~LgǧS[}#Iqyou?~9 Jf}QA_>\-8/NeI~?S7j:^?g]fQpA}Ǥԯ^oG:)׽#/}o{USsuzlR׵ɷ ǿu :eyQ0}=Њ{ݕ5 ͽNIu_$Q P^vޕWUU\{fzTӤ{TY>^BjbR/u]P7z/.Ϯ~XR5OYD-d9ꊏ?}ln|{MVW|.VE 2̇P,Kj=ۍ,AaFR]E}~#W #)O1)i^[oTIQR8 `Xt>p߆RO.<%u !kOI廆A多V˥{@( ӡ'SvV.HDY@dH N=mOxr d?AkۏyWm]@CՓZ}~Չ6!n'I&*oƠy}H>t*dk(R @"H?E;թE}e eEfuoJǞ-\ l\ſ<{LH͙}o.4\?[t<ߟPpպ~IyqN?_{#˭_(QΦ?_O{?.y~Iqbf'I_Xyu {].CqtI=w#ވM?gÛXi^ >]{o{ nw:z^^\݅s}:mǧ^YWKKX_L?I|z<ͭauWJq\\}oկ^!GֺIrs{Q> \z_?Cbǿטz~ν1NJpQIGP[L8 5!6 :ׯ-G^m7n9\ѩmrI4+ly:j 1VQ4|U wU(D ǰB'EO?➔=?4_QI8#бjՎ^ݝ+rin,ꚇƭu,ttrIv rWFس,hۇ-ӷ\˓zƢfT.5[hae oMx>/t\c6SZVDx 5:xp>]T鿰><]V>s0nR<8;,4( j:ge9c"}=uY9Ur kcݠA JQ)@"Hh㪑y"`rwFhrB(B8955j)=,ZǠ}Iꫪ~;wx .)&j}jtZHre7EU-}67o|hRjfqwuziV6KkiwI)յl 9:zYQ+]WPѴYe12){(4 Z`kZւ|Ig$5Փ@Omɏϱ6V:|xXJj*r%cKT ]((i2l~"->Krt;eV* kJy fɭ*VI 9wi@ujiy5$&ᮣp4=|6[&Vٛguv.s`vGfcP>];#5*DvGSO>x!V9jfiiiW5-M,TőY%bz%!Ql [kn*E8 Ӆq'ͦpsE5=LOVシ흌ZUMN*趓B,N;:*٦y8d*gOUu[ Aœd-%*4En)vJ{Ahx[GH\`x}$Uy2{OlRōE̱C'Cff`r1E1**cM LORIƣvֱ{ 喊+Jucʜ?#J~ޑxHbbrK}nkcjwxɲADr5T@_ bS,BKf3aeW]%keUğvi)`VŪsQR(i@zZ Py0GYܙz'dd:k6dSڒY'д8?LQjF_*$n}W< n.@Just҈fҿrqO+Qn}ĢM,DbVJ̈hr,7#҆h'ˤ=l^okdwm-]no*ؓ=<:CtRۻb.G?ٙs3)1XS#%?Ҵ8fI"!KcH)IbAYd`, t(бzpҼs^]GI#Pck璂`2PQdnCCJZIť ǜA_ h#c[GE+7,lн0eϑ)#9+Ծ&UgLG䎚;]=*e٣To3 {ڊ9阁ZMfMHQI:Y-]%5`XXM}q\pW$v6{O9Mw[ߍAi$gtWBكC2 [x=zKL>/>$ZǨ*#DDX_0Ouxׇk'+aCCc׋Dwr?X豛ښjB*1ҺR:aY"= !aؚ(?J ɾ=%e}%\Ygfbo~(wPpƇΠPS4MO}6 ?L߻i,WCPZfA$#BȀ3d ZSVLG4ηhifed#3jc J[g42ZnR4\u55291됞Mm)*!:TFViYf77XU[H?d\ )N5tJO)sгvPS4fx5,f:j1m.[:UAOJJbic 6,VrU*Ss7QЈJ3"T,I޷XQף)`PWP3iٝY36&ic*Tۦ)0Ҋ<&5Md&ya W?9tv*QS$*)|RGjUF캎,YF8| :z}LCN =_]M|av_W - zjX1u3T00)Pz:3#h Pm6')Ⱦ)i*KYU1bR ,mY7#MbYcHT $['uA&Y^]oU57jA4{mM9.ܪd-3i%]TTꤤx#2$r#ĨU&iK@%dau0J3ǽ&+>]+j|Ǣ~>NX[r˹?^ (5-4fYeka1 v &+QTu%|ZC{.` Zd__| 7 iE:1%74ci/kFH â-$ !Y u7 R_rAV}cKYYP|*N!.m'81P8[m4r<_ϡeN4T[7ʲZF_IDPԴPI4m$Ip m>>'UwZXغ4M'G<ԭN͛9a(i&hPH:b55;-4S̾1*2̢&!H ,dj1 51r1gPPz6ڊ;6;I7ɮ?sd1{S mt4饼02R(khS1q0GURs*js*S/FfI GmAQY4e&ТFʀ [蕘ӶiZ=4*M+ƕ{H]8|ʴBiR⫬5b1"/@#i.fQZz4֫*-q>$ {ѨSL~tX4NU=ñz28vF. io]٣TwO@&Y(}d4ZɼZE?:$~7/m0=΋ea+O}zۮwi*ezViJ\Rk"LE-0CX*!Yؐ~Hpn s9RxG?z3(Rend7 W.aAL#JrU$pVM>C;+f+]ZR%'m""OGOft mL2SFhPcobcgQ4Ӭ~z|D5J'檩o/yᨦ:X Xȭb?q#}<+} ԐQЎ)ʦ|')k(P Dȶ?$#V:/$~^jԴdjh``)5 YA' y-ֿ[c7-]"y)Z-.,!Vֿ ~=9_9%*^yc԰&5eInخ~g?:ιXڮE:xI@d:Oڙ o{)ۻh&/@{_m P4a-Dor}s>u3mp2Ӭg%zds}i9?ѯxjWUJp A{uN)cx\ěo|rZO~abf[Í-ӆk)~<,~G>Ztz?޽oxBp/~m3ֺ9Cr9{Yqsmõ&ǁͯϺO[[NA ׳)"xOz9~ιx%s^׿ ~8SCr'R ) /~~]?u.?{Y\C6~>ֳCr8(-HV`}./mPkذU,Ia_鱎zVḺ*ؑ{Nz~u}8?AOCïJIrM:E}KujzA?j`HX9M{:CX??^<+Ƈ^9nNT^-mM\O^믯WJb8$h:Vo^O\e[}\1޿u1$o}O\-<}-o)jG=`:#W3'@.M^ ZlGHjNژƠJΐ)ԯ'ԛ\}VBщ̅{Ot)&VLŒBJqˣڔ,=GJ[3FP+9$+'19z*lj(vty Jw7TVᏲD$ QQ=G~ϗG2B*iQQZLg6~ؤR:<{G5FQ*^y%ŝgf A=[+/vG) ?vdqΕQV;#j1Rjh~AM GBY\1SϮzj裎V i"ԩmBslYRAӎaQ@<?{3.?zKI!y4%.EEU6Gn-[k4$`4zUbX r<2z'=REjl;ظ/zVKnPH㏡6_o,Ϊ~MJʭUNQX%)HA%I {弪pR@ Nt\kA^ۊL4j;JO9iIwTm7OGo}۵>7RS==Z!3KtH1C>+'_TWTQR$s{5j#j!'AC%k ,:ὴ[76UzsG=>'YlŚZQ"Mj4F!($KrOq 王7ѼuhКVh YN4{XGȝ*F+1jF)4Fo(ʣ%}[5r&K6MwNIxЏC;pA[gx!Fx6~tob[I][WWQI 䕏H?kDlsڧ'9P InOƕ6Y]{[BQiM:~1ɠa_{}Tcg,ښZDԶ* W+L* \Td`#WMjG"n ,}Ȧ?qomcuu@Cm$ʡH~v)\GZ8_>6 </oqHuد-v9qmhz8fA?l:*iU"UH!aky{n#ֵ_ϩiI@Y$*AOGߛ9BWnk]ډȌ"#t<>Β8>;s%&k𸼔OauJH~,@_O{]#?GR=/5xE~(_O8ypg=y5E<~FY؝{q).^qF<߅O< Q gE*S\7{1p'YC(6bA#G Ii,I[qsվg)I&Wt._Y7s?<lF:JR(Q}`M3S}6H uRKss~?s2!{+ oc&6GMs">j,t A\妚HHʡx>=?ǦަŌisĚlF܁}:^"'&6o=if#Ӭn|OՎ?[ |*;.)BDG_FsO/חoQ[IIef{5u[\Oz^f>THEai+_|wEo3`v&d6bvpL2̜t~K;Vx\@M<:0Ung 5qONzS/lw]V-.ڛqܹ4#K C~"3GW*M.I1Pj'WKRjH, تw\wr8f+BW@Q.Go /+ ',j:_̛:t7ȾNCg{ZNЯleWF٨"REiJiDfc5>zņ|(bjʸHX%EV.ͮ4 J~*hj|Xc?]voñ?1/q=oܵ-i VEJ)i|ZtHR'$ZDVHFt:U@,&$aPS$TP8k qstMwMѺuAƦaB iYhIÊLu ?Obl>{I@ߙxUo ny X}}%DwRɫDH ~taQRj3JzuY2?DmT.:`u,u*]}<0hGs`x_>%ec*¡qO bMZ37jn}7;rbר,z#>ΜS ?8}o8']zwr(hwo_@}GSTEY#:bA6qG탴h3xTWnmi7O 4* ciY dٯe?Lۍ3@Hpj+Ey'b^&6ۘÊugo"6)gYgi"ܭ A/n9zr/3#Mu<]=PW$o,u]aHXRŇ}/@?9~Q2C~YP췎Iaߟ_l\~#bn4]Ͼ6 oJ7ʹJc_Ci:[ofc(֌(j*~_o[(1NWz_/|;Km{rzk0'tBT YY /eL{آCgUo迳T?mX{Ƚ\-Ѽv>yx[|{[/g?%G%x߲b70KpE?؎oqmzn/?o-m,]yn/i_ֹSn.d8ǖ 8 :#y^č0tɽ7DNGeFA2O<V r`/;ے6ZI]D3\@* ?xU#KQxP 5c҃wտi^ZlCdgtහ#SJ $ 0^˸^1`:1_]mUe U *qꋿ) ~g|o^ܝu 鑂Jo>)y#yU,Jt#ߙPazdD-9Y=Ǣat\p_[GI1QnI쾱%KEqc1x5 ^ISxA?ʑnʿJн)_g7x5  aDoc"97_6o Mi쐥NZg$ة̀p?A3ֵCEa; EC1&Ën}u&kCeeuBs"%~>%FhZNEH01|)>)\ ܀B͇h>0l ?qOe&5$*r8$?{dJK?wF(qIuH#IdGx(|έ}@_͹<񹧉o nAc>ג23Մ+ 2(w<7pBaqn5qu_zms|G1DiiE. Jգil`n 6oǩ51g#Lc*Zלܟߍ=9C"@LP3ۋX-CΘ:Qz33_e"t;n%IB}.L nu_)G9OHJGZ-iդC,d/]V7nZwCMH%Gn~{}ɱ7v9FTU\M +pBVxr.T<LdȪ=:jnݏ[HU& h+qufᭂdCכl>Lm66y)IJi"*FKB '9LFLxzӏ[t cSEuem%.̚t+ւaCVjquY D*Y/B{~Nu@X𝭏 q%R)D'XKh,! ƴQƼAxjw ]_3?,/|Y ,F'z~nds!BɪhCU24%\mIU|mMs&{)ٜvث-) MQT2F)72ٯak{S5g,k+@8zWx9Pe{mo׍޲|v=CuFwnZ,ǾQTU?j+)Ynb m_KCƔXj*}M䞡I<˻ íjII4~ΝVU .M>gR-Py:Y+$<j Hb(PJ?If$em=l joө%y6AqCOӄytS66[$5#rOONךhs%.pGCґL0L rREP?W^U1 SM zϛ {b'lq}5br4U1OSr, $)wŽߝɃս?J> uˣmڌ3+ +R^E6%CްƯukTeC [54œ=IVD¸ SL0ϣd'HtpoqO;KV,nR<V/jOU [x ʬ VY"ONS)O)l[h{ă$)I'P+_P:;3\ʀq 8?.G`+m}ν\e}pjڹTyCROQMEC$adiG!TDW[t,uS6>t@ H&{LۼJHZ#Ie_:nlqL5uTF&(\ue xE *d5"V3, 66Qkero3v}~ΞK(Ӊ$^]U&PFZ60SOE'ig=?_m\E\hX)b]RHA*wd^A?+֔^6=Xj3T1)`wQOJHɯ{;q_!gKv4讬u$CjI l.n U5ғ.RK/esof<2h8* *tOKGiĩka $x2rz49<`%r[rg;-M~r i*'wbE [dnU/О.>?AzӭGOEU"Td+Eb3JxqIciIfֺH#s~x:R>cFi?~j& cttөArGnɏk]QXM-kſqA(=+<5#hbd)D[Y6yM[&{{gF!(!T==A?//zuX둫*Bs;I5c8Z:ߚju 'U/DizLu˙@dO*LZB(nn8g/'JDWl Mt2/dY28R[06E;*V*-.O%@/k_nO3.k)˫ :jŘ" ^rm`,53@?"Aj}&"bz}<}=%Xp^}nӽΪ_5hIY,:5͵}F)(X#ςǁeo>\AR2 , lù OAO5Ɠooc!UzyG?_uXQ*h3r7 dsĊEƒ8<{ + Jjв\1T=j7b+=c>nėդqq~CKCiyZBqG{=+&1AO~޼kwBȓ.B2#ZVqǸ~tMSi]|o &R.Mǔ}7/Z ꏷEI6Kmq[݊q+o\MNq)cߛ4 Ce%n}vĠ$QAzO=֛z 5WXgPpY]7R.#n`~S<΋\ ҿ,gk y*ٝ4V]dDmŇ2 jr1sI,O_@##J$ڽ*C qT@t&S7l=N7ACƲo[}@?jϬ^t 4CpIG&\RpKlQ@-k~t=kC& }eLw=I7)#xqn=ŏ'wx_kmG9?/_Ճ7mѳڝ:b kީo<*{yoc\\{y14ѿidAuՀ#,a6›υG@Xl^+_:ֶ8 y [۲-R𠼬8kKs$eUmWk+CYcx&k#>݆5.>yY\>B*nJΏ2N_&o]g!6դ9fs7M8Z|'QIO] XZyU$X{$98>ಱWP̵tYy8-FRԀG:Bc0TՑ%%>}i~8VK5tJS͊b 3EqO ' R:*lR,loyru9IQU3!hx26,EJЊSSО.PV[]۵CW- kz9x*6PRm$2S"]Ea$aa& 3jM!N(Dz}ςs ^_nhRT: Q r,} s>@Mݏ#}1WohӴ){ X}>+APTi _r~7'޹pj/=V:ŷ^[O= NsHN:Fc?&ԡ^؁?P|QS\%mcդߓϵ!A"UN đoo;9<~H?{W!{p895ſ6QspqӦ$~~nXXX{:{,Û j{IܩCsZSRr508*m}=ˌ"[ƽZkFߋv@ㄜQof9D[\7~8cI7X[g:n럽޿]qz`M)Xʛ*@>ƝSrSl|SCZ)#?&J#ᦐM?ȸ7/O#FTg|!ܗ ؐ9IMI9|J|fiǨ(Ÿ/և=Orw3kPu!L#Q+xh]MD~HA#=Z)83C¿t͟J/{4bA*diѬiy1*XѕL,&}@^i?s5R=z #la5\(GE?}?Rum]ȁN@ln'G+^;M}?NJuxMaէ^MHDm\+ֺ\,\[}ߟt̃W{F$5,l??5{XI&Oہi~Ux9[݉S{WnHӏu:d+\{|yĆ{=j{:Yr=O^a?,ZvFp͆7AjkHh)+beEQ.=޻E" L>+DM[ c_%&w_GLBh!5[R,̥!H`fm)*fnܖkf;=ay:I-9ҼSa */QO( 44 Ixt4cG4/O%VJkJgt8-6[ʂua=Xl+]$_;$H*-S5ybswal-].gqsCM.9Ҟ82Y\ա QJ:h΢XH$T꥾&%**\GjvS/cg:sm? {kajz|A|vz&iPRT 9%I|y{ Ϙ+7un>}hq ﷚K!)Oż _ 4C%rDRqȯqjN8$s_~Tz>rv'M?lx^/}_lNzPUb*s4q5XX Dx39Rh·Ċr{hQ ;&2t<:M}]{{Vdx=އwa:SV.@ݲnL-u-% =CEf6ٛ+#$JZL.j'; zU=0*#p=2kT-;ne3Jс:S$)iwG*=GP^0rA:<|O>"\i7[_b3ijldSN~32;EsoplT6n6Bl}T,aT[إ7oA$Txu7Rg2$\ʤˣM 0@)2I~}~ţΕɭ5;"SUdw[͐dI yBj)TT7R0O &Pӽe3A "aY [pP3^'@pzQu:2ݵ.t[==V#'U39V3[{KE_!wF:"6MNjdK%58B}+'BMe뚲*W5#FXkR6QnAI5H$ BzQP SˏJ*$\gfm=)5^ޙ+)ϽILLUs%dAbB BR AD"!4P#_lрߠH5?SdnGWT45|!u?%od35&Zݒb45UsԴղЏ&Yiڏ1E&:TS&ޝJKDHnl3/oajyBi)B\,47l]wHIO[Qӊ E-MeP.]ܼp^-N i6j?gxUEIL`Fm'ocGEx:o:f/1|!/*i_W9ش8~UٶFuWLnJFXȄ2&K5j"DWQf}1m*j ~FZC"͉Wk,&4H"%;?Uힹ51C z<*O{Xh-.Jjꤖ*1=I[$Yb 4$RG`q X M3+UxѡMTc2SG+!iDd`A^HbzcM qqH*˦!o@{߆fF+A'" dにRxpڴ6+;|q)sĕT$x&I{UOg(c䪉kiI@8"Hl}02QīBi_y1hQ>^lZ={[rXjxmܖ>I%P@ ߀YPl}=dKåT!Vxj*хR|\ӍM5Uɥ1@<<]1yMECU1u1r I(tҡHUŵ^j ZNDűZ$FR9{G 4??ҫ{My 9}CoA|ڝ8f!ܵ4xh6&e{DꊩlR@vdK0U.E4ǟIX6 'so=!<8↟x6p-M*M+_YnZMC1⣦i|:T$1d%@Gкhclo𸤯!HMAI$X#ƽ=kF|:,.$u(?fH<: ;Ww?mvHڻzLggiT6sq ²g=YEoqXy͙ ƒIIHj7Vp=:mTaNM1_:sns*ހn҇?[qSxbXCLjfZIMt#Ȍ쿤fg__ɫMAcj%@JQTM__ $fH sªԞƵGWZvۻ⢤[O=:}10VoXID,T&2baU_bM&?^=&Vؕ:gAx\@E@>ޖJ":y|j)9?hZgx5ڶfOz|lGii@%$K$kk+Kyi:f66| Ċ5sTMZ5]F55iC=/5>>:6v`v=qnSUa}(E4P#dl %EUA\ҳӕ.pUw塨1`1BBT+oɱ?t0vxV|a%rjM|xLjK_[SgG&ծdk82X ~7.̐`[~C[X~;iz]%$kS\0uTcr)f :ap$rOMY D߻-+%u'K> @siʟ:2?Մ>)ۨqt9تhJϑj#PԦ-'_M"Jڥ-$hiJ߫oX\}HAPAJΓ ZzΖYh3iaj*imHjm.VFf!}.ʭ>=KUS<" |ZMf&\}`)j|CNWm?vo)ٹl^3nbjjR}MO*@J?ݽ<I7u}C5|4sֆ72:Lo$BR+棏ʾ}D@#>\qpbnQ}<59<{bʜh: 3A8*K -ͽ̮R/[,4MGKx)rLK 6PY[(EUUҤU9iC+]8jj\D}_1J)$ꕕ#eoP;sƒ;YfΒE%բJ5 Gi#ǎz=ZPdyMʨp>IQ d r!]i}zua`=pQYOV"lbw$W=Yx?"в*0id"|:Xs{?6[)pq4PnnpQ./ԛmhN {HoNY>acxFIao(I`#EcU_scdqJ7yH032a?"[Uzڨˬn16*JiU~T ?ĸHn?6>\ak~oԐ?ϼ \ɹ?gkX_|5k_qCӭrc}s{ #[O ~ָuݿqo6<}9};=&7j{G=xkȷ6?o=~I6oY{^5Až$ۏ~=k{ ^̤_eZ}W&_߽zi׽cX@T]CN?gX?oP4o?u\:s~=uᎽﱦĂx76<}~޺k׽,O6bAOOuu~`M6mO~]{z]&kxڲAX-

o4'ɮ20!{i28NxZ\ԇRb!PQ,KC|!ּ@ԣ ^LmYn>|)\/}GG`r pµVBBnmpI>{{MSщ)]t1?|"5]Mq5rC:'>тeArT#r?=J}$X$~=]{;;lTd,UWSVM&dKA{KydbATx.|KBR:Nq+:#:vd%u] QM#٠.|*HI[b}ۿf8w/Y6UX62-W0B ڊ~?Fc\KW<`:bː*4V|.=joG%6fvlodVT{nl>|nB\4QDJ+j"X|DIk@}%u|:ݚwy^bX?I`OJk\$T4P"<0ƂV @(]TX`-zSU[!{od}lU&Cn~Hy7qmz T5WA{t3T5i&I^_F'I-P/jK۟g[_rczO-mnگEzKnlZj:N9[Ξ9ܖ6_9)LS}GӴl67_a*RX > nlM?,쬿Ak_O+JgB) ~SECZ,޿>uP1:#UORpO&moêd9K&1 .A=L]U*Ij,9&8fgFYI  }~omN8tHE?~k+k ܓǿ׆:N -Ňaڐ( @$o?^}ܚub8]NGp}FW9$݅5I8ր. *=D pG$&2uzW'qN8Zm8?HԎOEM)6Xu @5:PJ#P@-~mm\?ݔCN~G\#: Ki yo#{.q@s7hz.N>{OJ2stURHGǷzgӊUyQ7N>kRbiv~ykWT2E} +~?{ {&76|Yɣ0AbHmBZ =O+lun7nK":̔Eb<)`~_/HҐZwd:>@^B^Ÿ0hRq^i /W|؊d ^g@ W, +޽_vdmHT ~6#q7_wq_?'|߸drX__ <ۆ_Ǿ1)_ofm7m=@>9O?1k1Ǎ}d<ηfS.>Tuf1>'\t_-;~s/Z~<8tdnB~>O5~p,Msl>dyc{coIj<^))oB 84nqxm.&j+Q8~Οڥċ E*t\X4oK{'cz%i}c$JjXO eB΁шa}{nu[n=1(/3X̧ZGS z2Hk&*™ T3B#"sO0xqtI%e*խieӘUJHarx&iڋcJӸ``z STq ƫoǦ+7>tqO'zffk2C}7? {ꭻMPUSUE--XLΏÒ#H \x,8WhGIg>Cz'orKW6~^gnd<%GO%?ۤf9)gH8> Z()a2ygoi'K1? 'HjԀZ%TP|+N'V&q=՝-FڈSbCqic.@,OԓϴoU-Qcy*3O2SvȮrxjiP~}YblU1m팎ڝm;tn貛#mT׭]&6hUf&9U%T[`}uF{frhmgSeRtRm%u^d]T2z@j9 V˫:W?2};C/;r]o6mV̛$-qI,^ȥ}s :Ϣ&S~n^7 Z?$'PNٖˏxae* )S%nfhjq'/}+w%Rd0jy"7:iAȏl7FMw[mf&?l@;HTnK},euq1I.1\zҟgE{%5Uzu3y+7R v^w\{UIސ+: n^1l20`$ֿOi%XkEV5bI&Wu6U(P=mnb]NA&ˀI&sq#HiOjp=n?񗥓hnS|ԝ}tibL 7H$HB:Ĩ,Fcy"Rp?^{QH:VZ{ʵo&2[x?{g\ Qg]$^?{~)UE9>=kßzg֮o{_ZWӯ*-pMSIhoSٹ6CijJ)(*`Bs"JHV>9j`BxTTq .,nE=tȺYit4Q0φʛpRmՔᯁ);faQH*2%46x%)vTal֟p{gfb[ocqLϧE>]ym[JEYTƒMʂ>OjZ|L/X]5b5M:A=OcֿِϤ}n\j6/b8,nuDlr?}ڣ'_ϤEjY+j'@XIt؞Gsrj&e#W\^׻<~0T L ePu ێ@{LT쬞R8+M.:"kP^Hw[N zU>ôUF lY#(+dvA!{Kve]Dм5+^XUb#HxW"ˡ'kv*yT3I^ELR_O~}Zeuᩓ͹)S%'FՔ4*-)`ǓO0*80#NZM\d+Gs5#ʔ\CEKƠSs1NDvX (# :6i{?J}_`[HM,m@jH<_A_Oѿ?O>ۨR@SJ@$k[b6c{iOϻgNW%nOfCwRR}STU5Ij[,I8mH爮it4["-EuY u^7+G*YT": f{.Ǝ80{W74jZuo\*Nu0]>YрP>#ϧA>Tcg|2~*ݩݟEjtZ4DF?426xO>W̎W8kg)ȼ@nH~O?u6ޘLxϚeSQ.BXY Z}8۟RX48qLJI̧Xஊpu1JhI5[YO)pMJ,,?>>_5=-.i~6I*}-yidFSQrTZzku:H ˨mm5fNM0u+͐[ɹ}0~4BUaF s _s5Tc [_=ݝ$ϫ|L61s..e(C)RK7 j'UKQHKMRO^9_|kkcv^)z<%,ɑ"nx?GScMŝ9$8B|%J:H'aѨq |KUL=nzeM) $ذ83aHH#Kd*Gl--^BxzzXW.w%i־:jţFR Vؙ oox}V:Tu긿67qǙϥk:z@K5Ooڭ`v{HFLД҆GtUe#{ sӄ'3ZZ\xjRzM^D$pC.Oeo~eJpWL^_Q76ĽOyWˣ8"_Z[RlQch'ܼ*yvV"I'u$UY OA b?O{jrҸy W#'GQ`LGpLȱƜFXԠfS30A4-bE>K3LVe?1߿G^y]dخǠ^81\Y?ڵiO.Pj(_OmuZ|?o#c{櫅cwoZ9=}H vvBn qa~>5ȏȊndXĊd`otM*Cb-"|yR58P5l-7iAO?N:[\!}c1Z9[qN^BafpJǧ𹿻dEkqt]e:G*(_o>Yb #ooy{n[ȩ?:}{AO?nuGI:³ac+bRH`喝>MQH ;6nCX.{zC?zlC$jP<[ [UϞWa5MTjrO@q$[0/|ϟVNG呞/M:펱uZM!bZ0oWbG$v<V}9ip#X׌n3L}9vHHb ]P m LtKGyDMrK6u,ki_JNiJu(GHCs{ŕFn*C}9ms{F`]|`*?Kj*WPg[*+bOnux괜5Zݴ^r G> Q?RPqԏ{w%WP@MJ`ˬO=%Xw,:C(a}Muw:MXJ^; O{m"*$ON NG~ԟӑ=I7ӾPzoWvCcqkol {LG+?Gt`+"=\!?:^7Ya4ydĀL/'mf;1Ռ'ލ%OWiY#GK}m"4~UHw<.>5x)?&߉jnm ؙy:{@+Ï^d SJޠY%?/!ݏUQRX9bnm'xemR9;5Vn }ǻȤ??ϫ*Wq}JK5GݓשNcK4OB]fo -skZܓ=a^.3G_KOfuA-DoT)R}};W?YqS`?>P}}okcKڝJNϮ92n"؏Wh#k'z7ڹ⷏R4Glm|/Ը{wc [2I %~<蹜9 OmYYAi1sXa>6LNacgR8"{5ؒ礏|pn-n=} m(CbX=qcCҝyoNGw)m ?S~4p+Hsjϫ^ˊ{ _׿68u?#Դ4߭Rf?/%$̍p/n-qll_o憄gbŀ}i76h3|V"v_yTA]&dtcܝ?UVcr鰷4fH1L ]ܭÁooU,}iqQnDZᨂꞸFb=-)WM\ܯ<[ۯ>ݗv|ZI1+ʟDִz?Sʧ%ηdUMd}E"r#Yb.{q=L6yc.O[m`pM5@?oW @R{ukũ+`R>yD6{A^Ou&۹xA"I u(! !5|~t2sJn,T8;/k\E>vPp#R=*URIJmaaMFs^A!>.I4'dS+- B)OC/]{B>n1GeZ|'da7CSIS"CV@uF8]ͯ 9 Z9*p+rAmٳ\`B(bgQJSRts~jSM3?WW3 m6SNxکGA-ZxB)ܚck0J=vUȌ`6jVE,Z0 +C}O[9 Ձ* J"+("j#Gy 7j?~~?oM?!{cGxx4B>G@1{ HW= װ @e}WX ~~K='$gˇFW':j(@2ѻ(qfe}-sC#xy{{P$W޽V/U18 iƦV`.5X۟극>1:jM>lGӓl$+(*kdIc`UoTRQըH [ܴUFtQ{j:?=TkҞǧut5q,:]=$s@I ܃w$㱄l\^p,=c=i|0pupx=(QϬcZΆ&poJI\{S8Wt&] oJx{vրp֝UgGˮ.)P8ڹǼ6R%K[EׁO4g hBUN?$oj[sEn4؋68 8_Q.d$6MgէPߧyz^V,9>I<\hx 㪲 IZM PI9UR1. l@{ulL61*I`WQ /@??n?Ѯ::ᢚ ?b-rn8ӟtr PE ?o2Cea{Q,)'5m͹ 9pwt}ggXа B./ְ7^Ct~z)H?ɽ=rYl۟_^ǎ(a3R9$X$_oHMIvPEy{yOZ#(O<{ 3LERmoq+w=ӁkOӒX8|}܎~Υ];] oߏoj#> ӒqM5O ل9?*nӨ1oS6oj2"=i?WfhzW_o?}슎{8H7ׇT#{)<}}N=ڽx ׯ{Gz7$Oz&XvK~?7"S'_WR0%LJ_XAsb-uH [7='vc{jazMz;?+;]ns8/#}N>]m)cMT3lz@Z6 I5n- i@gT][rй15 D2IpU msxY,H ^MT"+b$$M9.Օ$UgNY?u+j~dD0H& pxO<-ȩSH_M[[Hq|OCu-VaƿXU_ޅ*_DZs~ޮR}H?Va05@F;B_zO?Oot#–2 6H=lqH?p]x{-؅'sp5z?׵__ _>?o\&}m_=Ѡ]CTBu@-ᄒْχ?׽Ny?~_}ԃQ_Tν+-͇Wk97`@u~ν, @l=jϯ{~n.QWMz]{Yk7<}/O*uW׽ě{syj~^׽dkX^?Oz ꧯ{fbIH_f={2+j ~m>޾ε_N %uHO?["{XiF Bp.-=QVX~f=ɊS_lȔ5\QD< s`6.G-ĕ*悕l#9'scTH_d?2{3 ۇEt7. wVF&vd9>F v g}I/wn4(dX<67)I nVgࣂY#Z 3T3BʨN%RƆTF?ƈʮJ$ڗι S"?ⷱ0{im,mʶ˼elLmmqs,KMF&%I;;wV؍j|d4Pd6qU.Zq4XbL)mU$Tk^xy` PХhE~*~.v`n_}].d?mEXrԒ$tC+Δhw\5Q׏oKj`[WsQn* -GM_VU ήHZO=n[q%c@';X Ӈ?oEqx`$ʼn  $Ԝ҇iߕ4m\nۻ>QwV}Ӓuf,|GzpRSzz9h'%;7۫7UX^CxTly7k AzqXwhP!4:A ,#,b J*,kA"_MbXU [H5ȥ3c$;ʟ{.wWa;֫{ sI*fGwz3[5ۘs |Tdq.@X ll7bn5 vnzJUB$ QSIڥWs@+$@` *$z)ɯP|ww۫uyECiv^;r䳟oL%tTsU*h) !i(e˕َ^`簣ݔ!W< 磆WȍE?#ĮS]$UQH:\fXUWwSTj R֣jwo폗kgO뎅nˡ뭭 qZ-sW qF?Bg 4r3E_~** -oU;z)Xr{`Uj2}i * +烂=HmLT-+W/P4syisiVuooaO:rr(y _2uκQえZ%rzl.luft-|7 =kISvaf9J㩚wA_ArZN ūJևOE| UŘ6 ┥ 4た<ѩ!7~.ٽ}+U1z `uەhomj*:8.qF=5dT1'i$I) xϞgR)Rk2B~fyztHᖀVJx LQQm'zˊl谸zxj(s9U튔詎* T,4!?SRȲkcMHdThcT@$} {U4u5ǧ#_E_.M]luM띅U 3fM`V^}?-VΰIZ|:8t]u麞ò6o^ QAI,5Օ_S$ǩ8+90{d6a8[F,Laie`Kd*E,=)@js@hMk`>[*h2 }"zv}ocǔ~ްZt&n>+TiHLTro諾גf(}7HY)T05,x@:l{f?څj<ͬb3J&ּq(z{΍XmWds9;6&'6z"fj%p!Q`=mlfKMFg!K2ih\5i/ga=f:Am3|30쯯F}asf0ukòUUCpS+&V[B V)"UT*}6$b4ۤm%࿃eI"3ouI&įČޢ Q4`phNKtmj>Yݽ7r4`V_X@4Hu@Po{'MTtىƞcLiYlHg$/~?>~٤%5aat8~_X: )29*#02DW- f@":͕JjoǴ0KO5|NCrOoiew)AN>y|HesL*>/yei!lajcy:0**SҴoY0¶2RSQQL2`-qm+Vճd$v}:&,$4+zicϦnMqHfvM VhaTYV!BK~%ih)W>H  Spۋ(4hEp)׉Hg:rOOo7]_PvWrՋM{%WD 5U4*S%kk6ݸ3Ein桖@@@T,>w5T3NMG^FYBqu~uW,:6Fh$48$$Djɶv&LC#OM/QP iPj6(3RI??tFJiL7BrvX^fdj)ĻiEbc&}+h5S2j\2M^0K }qBȫX."ߛ{mdk"|_CȚ_z:*|.ܡAi6Ի3._1JN6-4RTOhơb|`nYLqEbX^K'_k6!vҨk]]qSLTd 'HuP:\tVnNܛS'*qUS64Tqº[aIR7^"`Dtk')91z-[O }!Oԏt (2<.F y`:t튁|E6[=v̰"2joj oܜVOEF5@NZjsT8hBzi7Zr* >:fox>=uahs9KT5ff79$KX"4)<8秧ԻJHG8o24E \=MC9,1@Zbm'A8Phz!]n}={ UI${9Fr"QXi#?jSW1`ÐC5;8$+e%. ʒ?0ܲq5?],!CC/J )C:(T5QXO$3?wKK\T[iZU"7/X&P-pۖR:p''d{6RkVP֕Ϯ:7;Bu-lrTW퍇aKdf*18[%|kC%5tp}0-\IE \GT)G$eR3RO|۞iw_X+nl O_HC~df()ǶbHK4+HUP(g]^AUϲŤIQLkoiSj09tfwj[tbj~UV{j@ztBVe{jU&G1Q$N*0Z%0Hu&*GC'Q$׮+isr33t!|.[Z&9>2A._aIC6Q̦t(XqMeZg} h3HYI<(7nIZҹ4'1S/l鰝g[2]òw-J8Jg!ԭ#PA@TُmwYix݌1KH^BHAT 8zb]Ez׫hX4uE w:[z(L/Quhk̓ߕXeܹJi39/E/͈%Ȳ$>]fkĒ1fx2]~W50LD3N#~APܚpI1 E&m,8T_}yݷ6kVłYllw}0Ǐ婾%GjqhtHs鏩uip9jJXTjhЌ{׹7H[WAU5>y28CK9~5%ħmxj|ƕjح7w:BQQ=Bbj!zga8'ֺ_+ 5H’ J~@rT}6ܲg(Zl.iJLCP@WAUiC.W(P׎G˫FDn5M0ܽϿa>Cr I437,Vo Z-a52p^tq;'O@ԴiXEUW,ұ:ąJ$}AFayaHAYx@ߪsL'=GK$x&zQ8ygI䕕uZӠ'r=,mA* q;5CPQ Ӟx +x qѥOۏjx* }Tv'PCo,}ΎȒ9Tkؓh.J?NOl#qV y#Y㒹dYCHd#OG[>ckojnya웏}j6~.)H .-:>{Ūߍ\=ȧ}wXߍ_ЪOj{e<_{+Հ'T_ &bސo'n}sKy\$q0?g7Rԑ[uSw_ϼ&&So]xc㏧}-Wu[8?$ٹוߏo}X|\%J2 {5H#=<l#^Ju߼w6"pm s߻o{'a-?-Lkׇ\$'ڸ7B _ӏ{Ӎ{I؀M<[޺JnUGGީ֫׽nlƑ_y=nX/qouu|:6&~ܰK.$$ʀSϦē/DqץvV?aΚ7h۱H:{+sbn6xB?K/w?HHgYsl}s`cB5 ?931Բ"ck8} |&^\n"_i'rG>s`#SBOHpm H9Ӏ덑=iP]#￧ϭ'\ >o pY%[M>\\*Mx#փie$TM$iZjh?Քp 6JV?_sY('o2.p$"ߓLHGJo4 PtdooCL.%_+$ҽ5qy[ϴ^G$4Qzf{kH~cDMKl+OKz,W=p\x~Sc栫R}ӑ-j[jmnA<`z<o0^L>>XR:YGonwӋ!pNMowj+׹o/I>q*ɵ^]u,Ӽ2 Tl^S{0%?~q/vIl/H>֩J$e.uV #oŸe!8Ϧ֔W@$< `~~EH<[m;z]NKZ׿G܈-B@x'#Z_pt:M[nG) :u}~y+N?oXfk6,%ٓKuq&ozT-0EU^?>ƨ-9?޺N9&ڬPaŏO>O!ePur?W\u9>j%-so+;F5@Oۢ?>Oԑ)lT\H|}vs7Źr trTzmtf9Ύ y?֊y';ڙ2ݝC&{6>X=!m\67[?or?HI y}XziHOPf@M?)kp8GgǍD sosw/.W'޼i3KK.U\j@G#K&Z7:&Ph0=+\cθ14 L~N7ݳ[^e)7,ԹSʇEQ RmssDz6$.f7givGnM}ym誊 Yj/6uhXĚRE'YkQL=)rϩ2Q( h~d˒]N|?Sߙ)ڏR]T;73(iցJ2#S1Sֆ))Rv_XE A{bTB¤jiqM>3򡯙dtZŤ4ֽ{f Gge&rG?ˤkf @zץK&?tRw[I=s5FŁ-` {"|UDz |)J]T*R4'?[i~΀٪(oU%U%f-'7v$ƯoSҤGG41-DD-kS~߼F?G>xHkVVQ[WQ!3M!JmCI}>.Wajd zN@o}DoJeX"]P+Mޫ.ЩڵԹ+rs~޹<o{-Gש{M{HHyIHد}Xq~@<}"?oJuWWAONe<BfUD`~llcr˦*Z%(ooo2_ 'j3A+Դ9i2mbz^bv JH$u<3? kI_~ 'td1[u ÝP!-gu LR n|}udQ+Al?~ې^B@WFKGEE,qA!P&30?Ⱦo0ҋz-QX&~^JC>~S2GLVb/_<NO2C1٘2uH11^_/Ք>Y*~Yj$\摍?{$N`?B=5Β xGoao{cq%hiAոuz p=m\CMGONfI':U#3? m$Flvy I,$pCJ IvfPIU{'teܵݭ\xXWW>X$Dmk6 ozF@x垔}<5C`N*>`_+[a* *L.FOITJ[%GI6L'uzhẆH ߍE@z?&vZZ|٥#"jui5T蕩 WA?K(*u_6ЏZdžh)ii;+5-C:EH?[=\G53TA7.AZlX֫U$=,H,ckISoh Ry:ӥ˧:-;oGr#O}$ǎ+&X2t xRPs61?#Iއ W>Щ-ǟ^  :4SBmϋD:t.}qV}v>A(EX?ǵ)nIϗg ^B=KU6dx~}iU0CAPąSWaH$onH4S^,_HylF檳P#IW{76CV! M}E~^<:Unm_6S,jcu-?T6 mUAK-=| InG28<>a*~=zY4ѩrKs4xjijaoP)MM'`v'jcXhCJyYUqh䬲ۂJu"qS\)}I1/ /瞵i㴾Do[#u)v__Ӫj,uRIQ\RZZt# `T-,S15LGՔ܀X/aލVG՚'Vi?NŎ*jFYD4zE"Cd9 BыAO^>f<~_?sAScbZriO >&JqxdhT[ CkߛܟvV+HC- Ѫ5.j V^Q܍l洺ZD*Hkj$}aμ3R1P+׆nEG$ %sƢtA{ŏ6>KPK9YjKHHnCڨׅr|~_?i99:n7AA2(|(-Ź)V99y GpP6?CqHr+SCAZ#uS1*~|5"Fdo*1ʫ`&7 Y,X[ ):xf#ڋxP ^9G}Imd3mCK-M=ZkB#FgTH)! !mq}W ňvqGʼO84z5-TZRF=j&[O`܃<$$"0vN=@oά@8W[\u|~[6e^c{?K ]7d&1gE9Up \}/ZҕΞY3sι$'I -LY-}˞BJ ]u6l9?,b>g=y<~Ҕ"sX)L1ʆUO63/{\ҕ, ũ+)PrE︫&]RijUY$\n9jH/(9 ;U-*4"Rli??On Ik_$LYS`n6xFi*2??29)x7ω/EaP??GEQlt1u94pGn8?D,f0G2/r0<W8 84ᎴN/ӮRѬ4ِM*+)`ٽ7$/%/ͩl߀Ak~Aq1/=y\됈ʉ@6T$ʮ8qaڒPPN._TT,U:bZzy~:p . t9^E5;$Zk1Qsg%67jYƪP*|nN?._3Ǯ0@N"RVh$mss|yVh[yԤznmFP~}X֝e0XFkHcDW2Z kmi$ªR{\P$1R@Ƒr`ʥxӂSxf> Ր?E)ƥo]Kr9^>| #ɫͦBZ=\ O6oej@Ri|}$|:pũ]:Pd>^䌬R,$yS1-`Z>~ &%U\4eZ#ópoLf ?ˇϦdcZ9=aXZUt{&rKX_LYu}#_}hB(IO=9 S)`{QpPMVo˔nM"LKD&๱, %n{id@Xp*r|Y=)Z}k^:C)A%\ѻ+`S'J2a(!N;I+I.T2\܃oNI}W{E5=?o.Y\x>T$γTH'2E::Eΐ,ݦ3#,J(ҀyE<(?#A|12Vq5#A>U'd,YI~$ Cr87[il~xRj?ǩt$vIn&G J6nc>PeJdW ȰqrEk황z xk_^Hq>i%UJ8DXMqc-/ pue9>^4ٛn썝qo$KZ!*^yDuE4Wչq5꿻[+Pp{wv6>jFplOc q&B85ḇ5o =gՂ'^HIYaNoQJ\2ԢJ_ݑCq`q[ת(#798hj]V'aޥFp~΃5a ꥐ_bߎѱh=5(ۂIO<HX h.ޚiݔqn(D)sW"XXdbǧI>;X@7#Ŧ8 Wc>DE]Nq$oȱvߜR > I'HoJU:pf٩X^DahU$#EܲTME><?P\~=qQqڌӨӛ*]1/ppֽ'H[sonLAT"?(e6\~ӟh~D|?.Ax"u5KhUI]6}.9<(o}_= pGοp!b|sB,O6ۋ [Rif6f7=3/yJ~޳OT),j9uD#>P }"Þw5c)S")UY6/c@}~1f`t,o[n94>!?:U޳>,Kk7Sm[ÇCHG[vFtzpϨ.m?[^>vޚU?Sc= \zC X脝W_k*Y??M%98t $P}$ؒaVII<~F:o{[j׾ yO~}<Վy϶9"@tR>>ӄ|A? ě #PN0P?=%?톚t`u-I$}mavP&Osa7xj:s_[ED^wjfOxtZ~^•?O_o 5~΋>}{\6P"_ng{#|}g1^[I^ɽ(t X߁{K^7ןn:n{桋 G ]XV_[?qPqs`\X~=Ez:m "?yG~^'HMϏ7Q}-{Ax5DgDB}~?RhF&}75O5b<7~<P~u<,:*GV;]1TNWNV*-krNl/w5dfwRL5?2ccq7O8SUq}q^<۱'txM<į-G;[P@ X~hq^FBŘb~[}:4<_Zzٴ+髥ԍ~q(u6O})cLz;x'jWMOk./A,NiI%`R5C G'6,pObSAtrho _\Iz1\`Oژ=kmұ@e'?`:<܍F $?۽>\_muXsǤ$i .M/JpJZn?@Vzlux%@$ϭ~;os<eM+S^]Y7JYSuϿ^kPWŷf 򠢆hX9)$i*ҹ+eŰ(v\TTe\{u1 !OK7+usKDZH4F= krVkL:F08N~ QR͏g5,kduc]rjvxRN|!9^|cJ!*ҪV\jG&OP==!yZM7W 6?e1i$j-|8|\s_Uf25GJM!U ߞNېҚ VZthU\ԯ&CDZ[#=ŵYurۗyWR LVV$̵*zx4`mW/wN[Y9 JgRFtzS"R~0tҀCS.JP**rָ/'[;c>n迏!Sٟܮώm}`ri7wnnxD%RBr ov=ovݟgg)Cu$> `8gVIkx՜Yui$V^D*2cFw}qnmfe1OWdbzx,Gi-2,A)_kUN"oz |.#4 12IWz=BJ@޸>J;0x,vtۛF)Ik2QpQFBaSyO2]FvH!>&ZSFojX((a41GCI9Dp*3ؐ nŊeJ7n1# /pärvN_;br=e47j fNU:0CNci QvXLMU$Fh| q!TX7{}u\2qR?Uq<8W٘}sx11K=h53T@bd xvOyإbIWSQ7H]|cXlRh;kFqP=i~].HM~m;mۙY9J5":2E/"H+nO*j_;6BYJ:݅7< _:T S#Sv<`3$qц3j F/ [6kEl?!s$jvUAAh5jGY"W6sMS*R+zu@M(Mx pݹyPPC#3ּrK_RKLT I(,,Cb3P#W/nGZ! HO(lKi?_j%F='Yu:(~U՘|ubrk[: odX#7YjԮHHhV# F76@JtDcյ\lOQ4Bn|Tvc$a}iCO3^2됑Z5E ?17fx^ՌΧRj\]= ξh^9WO(m&Fb-' =2?$}HѵfZ<&cr|tdU,`n)a}̡>bza/aGUSAp {GPHx7+>k AR&%uHklEEn|U._l$C!^9q2SAU 6D5FJbG w"Y60V1**`Nu[,l@"?qѥG WWBbLQ=AN*d+Q*ZHnx/^صhptjRI3Bkƥ[4$ycz8"W9>j?ԟ[h(7sn* ~^DHWTE1XRق<Ϩ;m1גJB)к:"*K\O= ,>Ϸg>\:ݨX_^*>v#{=׹j`ЫJKe%E<TD3Qp»63# V)C^OrTA#P A>lv/>Mju0D-};5I x RJ:}B rZ_jiKW."!wfCJfϭenJjALJL1N&R$׺w0ܸﶏ𽋻9QKxID lu<ȕIP:ugTQ,+˴&7cS @xRW/խԀm|7}_ٛS >wb%`t}D>dJ(?V5$r㪚UX21*Q`IujyB" V՟/.4Zq-gj+ZtC~7CvT%^kdۤ3OnyHѥ,KA&tZHcicP *c/Rǟt:(iN?*ҪK4>YGMqm՘]yڙ-ۺ1J\QܩdBBy8,=J ;{P"1UP4(u)1[1):x6{*ҿ.Ɛƹ<,q=ϔozA$mYD8=J㑈Yֵr2f^nK?^n:#Z8fP kU6}M $4S?ˢ4u Ҁ!`?1ǥwAf-;[-{_#+y_DʧQVj`CS!F6]|&b ):M :Y./k!ovaLW ~]( _˧~+mxIDZ)B 4c6;#CܕlfS q1굄}AF x]K+cM )'\Ԝ||RO`pf~$MZ47Rlu*%Z7QYU (2,T"5D#v@p4) V@A=/>'gfɹhw~+{je|4rixg-+2VOaj:XX${@ׂ_[c>4޵O~U@_nAE%RvE4IUOM6FjbUr9m.JWbjbj$  E!de#V0FobW輛[d/ǁH健8?0xt3[&hT:iJl[ݬܼ#Qa 6ZMCD%Ɋ4ca+WW &O < V󭲶%+qI1wVDεUd4nS UԠ+PR%\+ꄒTTVU$@5*pʼH?glh}5T<:uUaPp^bV{A<T.U'"G Pf}VKsˍGԈg;GRPES I#*ĂGgzZ$SYS\UZ7j%`/A* ?o o׫rKpW_׸Zt=R!BTK^DA!`*O TrG}xLFp7vĐ{%>,~?4V<3EAx(OƺZM: oEeRЎ#GaOsb@?9}C7Yɑwfm*͹s"HX@Vxl. @u=uӍӴ[.y7mMd{1S(,B(k䪖8z~_SgZ]5-\t anf23o_z0?PUA~9$,q"<ekcN??/^k}ǁ{6m`)ׇoyu_#srXj-ƭV-oZ߼^#?6},[ߎz"޸ut<ݭΖ[>c>|2z,%{HPJk6׹[^J/xPI?m]k@m (nE" >HU~^Ğ8}kM\ϾZi#~Iaoxnׂ_xs{^ׇ_}>T}Z#ӮoIVq>׸xly޽^{ێ.PZp8~=잮q9`81ֿOuՎEzÅ[[ }Gu^f ~=~}>~ |F}I?}oϯ{Z?ӍJr͉̤*U q{xgOF!vI(czC>r2)S"4[r}4Q}9|SI{ޞ?RIW1ŸWݘפNp=fy: p@~"S:]GM98okfi46$4?OvWҀ's5~8!:&dw6[КtU>37zlaJu>dREU#OϵngiRz }om:I0E;s$=%\BX>1֟mT/h<cG?޿=5фZg$|pS&IrYI6ğa,nTc)2EX&u !ok_h..Zda¢%:p6*/]jf:ʄ]@O?w=Ok4L4^TPEt~F<}~9z?µ&x=y0j~.BͣKoW櫷^><3mSy ܪ[(Z,oн2cp{0ҿNG#??rTD}6*xd:X'?tZqX#~[bnx`8ܢрxk}-^izibJLkG~ɣG[ :j,u?_>b|Fu'?}GM+Na鶝^Sk}b(ʬ9(`y XUzjpH87J`EƢx6= tcqn/d$ٹX[8<t=P#`=7OG2?5Αe 9Jzqmrnx6RǸ)8zv*:Pi$([}H[P~S"cצk PT2}0r,.)=x]Iܵ"}õ Tp *[Hw `\kj3@(OoNMY?^<5[v⑩TwNVrZJʠ]-QGTJ6LmMd]4X)2H ƖBG䂣BRj}3;ۯ-P P14:~Yҟr{x-&3U18Uc e-d`[a>6wnCVPUUųAJ5H^i$uJ9I-hO{WHUUjԷ'H#mNO^`~]/#}Uu?K%G)ЏϠs6UrǬL3YVch$$מS֟˥â*k$O+P돡珨?eBX`uËb,O65UY$UKǓu7qb:$ҫpG԰b~㦹dE ( -j'?N?{)ZpARO=ít.cfVP#X[m1@@l~^u  Oß%"ڍ6> 頭Ij! 4HJiqI<->c:E[ۑkݑ?_W~ޘk)UаTј徖۟ǿTUF8K3k68!#>Y$Z}Dբ)E@y7y6'[lʭ,cէɷ>s:*VMF r>(+qLTjZ`coNB=zb+^0KGJ=_Uc϶z#g S>/A.:QzRPa43kOO3'R}ZcB״)#*>cGt e]("OD,ȷ%9GOiQ˥%"28yxڦT[ih[7M^êCQO?}PҽJYtr.mnEU )7+Sf#n/{Qڨ'\z!BS đ?>+[qiCU(Ƣ 9\5O|h<~UlG/Zf&[zin--,n敽)lMKFW#HhB,jc6s{RԪ˭N4_5"C& 9FQL5BGoŤ&B$Ե4@c-7H3L?NTX5|xtlV篯UZoI.UI' 7>8LˢѶ:y7ap s͹ iY`<ntX/R(쩦"A6\E-D\]:1.^K~?R[Y.497I=YU7ZVi@b"sƯǸ2R+*p/"Ñ!9szYb^IZ)gR 34\l: к(*?O1H=;f}C=4LQ#WA[]? _uCr,jT*%ȳGqC?Q$'%(_=$/O?8\]F'M(PH.e7bߛo?gT3XbM_>QL${P~Bw\%"rV>ͷ{+ .ऐ+ jUT+}Uu2m˨s*0M@fd(y:߱8#pDRZH蝅QI:imtԬ|uͼ z}&|}*}DZg:".QnrVxTjχӲFU=#1_&0ym^uժ=92])hAfyj qbUEu]F5 mG(cLu,pJjF $5( (f[Y-\(je<oD:bD+( dtkM*ekIGH[^f< ƣ#1jqTfwn$s *)D"<: (`ZG:r)C|"&)[޵?b:3fVrx-_{P qo7{|^48XaQ;CW0(N\-bY/?;̟)bf])] pȊx x!eƟ}<#8$sQt:!gbр0ܕu8^Təڕ)5] 9tP..|% j4ZV> "L5>z:_|OȬ{195ňTYFK15̥oXbky`$a#Խ;)M65@y҃ϏK֢ ]弶ZoI"bajcJH+j4vA:cg kp8>~7!_+߹sW5IC,螺۹$IڞYtm,@e"Ē,lO+0x?WkxJUY"w` ҡu^@RN:*}n_ І-ovHK[S:.<ĠΊ&ˀW7Evd'rӻ%Wiuv$2@W9Gy4/i,2C!>yևDS ~~߅};[OBP|x'YWM $.$X܃_ՕS]UJ% Ա)UA^}1"RB핛$?i=MhMJc(s#/#&ۛjMtu$xf3`tČDzH\6I>4=/S8鷰 '>\TˈcS7AЌuT֟//JyVJ1Um4Y(d*`˩F[&>H긹oS%8]wʗIl+Tp!ր z؇Z\ȚrjqPGI{O#yhDhxٴj^<_ jO/먩rpP'!LJ1 W&SZb5q5 Ar|:>_x싘_4 1XQn9%m7c5hHmI%Eߒm?K3%>g[z7.VGL&Z*ʉXi!P,:{̵@cDIzJ׹$ZcRkYƒֽLJ}P;P4SjC8RkZ\O%v,?ب(ekۀG?[^6*SJAiIGT[x4nl*vVߨ0 qFC_. Ơsc}Nn X6{q`xh5$ʟ铎6ΫSpUL/*-7 ztO9*j$ϤY&B88ACր'CDnGNϴQ` F6۵[ ȟt`=lT]Frżt7-~ܬZSӬO2?Gs$?rHXq ssba 9H4vn'EBs0%a]WF+"bm]$o]"Q6D}Ƕ=RWrTXG~3VOEF憵*|x)O^&QAW2bٻ*ҹ:%{K簾E+6H_!EP {m gB +c-Q6>}nTWZ3i/s_AN@?Hc'\k|OL2-``G';K ?K}}&G{kѨ~E?Myl$9(>G9(y=Cխ77eq`uE3őEE|؀,x1Z'֟/cϨ 춒I a JrEm;3:98rl/Xs{xvӀ?.T#w,uodTXR/$I}6ZRXs荸b+w5X36/ȵ1hs S5`>u~ S#;ɱkf@>V>UG!)NX4\#Z0%c<=+Z?_>l=?ΣŏQmR V=\UpޘnTjy%G8'j*ujңMn9?ZXݝ51SqCGJ4juTz!з[Ҽ *ӓi8Uv2H|C<( 8豘WϬUVWUiBJ2֫kIRI'X7nl=DWǗgT?ϗSFB,t6,n@Hlu`G"|!9:IM.֙(t<r.jW_œOܵ ae Q QlM^ױOz#wu"9 :W`/ 1?s~Šp@ F)ص>xdI䧠$ԼM8h4;}wt-1I!jb[l~moǶstcTc\&G?&&A{ _=]Y9UC}CU䟧%+i(<i'\[XJ]1P~ssQ_/?:|#ϦCTJk;%U,e C-ח X6M߁})?թ!#Z,ߒOyC{|W[q4=L 6^mί~ĩWЊGo?޾r۞ϬH]؏_V,dU,ߨ'b~ҵ]8QhzOQ[͸#.XyP}ǴMЂ}GM;7}ԨO&ڹoݘc\GT~8Dy?{ DC\oۑWqOr8*^9.Tݘc6}M=Out-~Q7'@N+G鱗aU5 9u%DA_YiIa={rP71oGt8phV7+{ݩi׽d -mc׽@#@]{{_~{Mx~?߇Z1o7UԞe?î!GG6\@$qaßom{_hnˌQnl;\)xqi79F'ٱqUtpj:skGox V6oPc}/(ŴRj#l؛BI]CϨ'T֔k>JZy:JcE.% ՗](]14ى[; XOfVQxAɯ֬Ő>=bAq2Ƒ'<,Ŋ+%E=8G3Ǖ&ב~lAVÁu![ ˷ uOѯ$q0#3OZ?ï{PZ[z7>U8AG?{~%|V^S KߜhZ#{u[{hqϭpƠ5.G{^[~>b:^ocM}}9::.<6?={heU:y(yΊ$ͤ8j &z%E؋5DGz~2TCXPoM$)QUˏ9'jt"?H5[H7#>n5l{}g3݁GĕBrU(((֢(,EHZ*~YtAl^`\9Tl>uXuVuTYɒ%UYh1h)e֘#Y`fԌGNjԽÕfh73\ &glikTVfeNx8㮆p)^' 33҄! ﬞ/&rdp&|fFh$lM<Ġ*5Z"9PHO\1 tE"$JǁkQM20>UB._Ɂ ku&NnmM"yf10Ub*EYSnA2b1tNfMM)RO~Άpm ՙúw^apXf{ibYfҝB"D]I2(ǐ>Sh UV)hsnw#ݽ[7L=H}ǸcO42"P|c1SSj*'qRzÂtvir{`4tuPW#%!1]B:QƮ+/D+ј3p,H$c$Wv}c{gu7ĎM׺k>2xi_{E#6(qc L%ȅ6nAJ+**ގ\qHhᨚGvNTFʶҖbm@ *4Eh|z ܕ*W=T y׭>A^wWr>xw&7t=}dd\NCtTnܭf*$ME5#T$*<Āz=Ҧ_Ԑqt{m6^Xګ fN,1}$APMcVBx|ܚץ70QK *U3{h@>]YV^Xv?jw%CIႣnڏ.*YiđI 3BK5knnŕ0b*ᙫ"NA!bȚ@g&22TǀcoN%BԚ1ɩTò鞛5cjOwM7, hj0&t>:f#3|̑[OAH)B:ČYAĆcqkkXPHIA>DSVXzq"3]#6YM/}cI0{IiJPX3dpkOKubnbޓKWٯK\*mbR%4TB.'&۰>kI2h3i~_Q\iF`ƢRPև5j٨OMvE>gǖilMZK)b$Y+-gT-Rh'H NYmecϳ$y)u3 S,sLW5= VF-5N3QmDPC`C,M M1 Dڡ+#i: .TZ[u2XМ #q\p= P9F}֠cqFİςrR,jk+jı-$ JQԪ5}R3Ք}z*DhD1_BBXXOGFRMAh1QF `Tq:>kٹX~MMM*]v,Kd*2y#'Z#Pf9t=[6BzvOߨ/[6#ԽkBoE :W=z|~fUTmʌ^Ia!E5jV\.稂LGr|](tMϐ-/ TxZ.G0%=! f2DXi>:SQ <1C0 ]#UŖ)V, q$%o(O~n>c4P<8 ŽqhM}|z01+uN7km,M]\MUEd@k\#K >+X">bm]5-DR.FQuuUX\,\a:y>@~.@OO?:[{sgop;RG5,RwC!WT-lH4.35Kv+qM 0Ȭk#Z@>̭e0iS+O5iAӤF j3R8\zEmuTTIڻWn >&ikSLc)jfd}y4ncuYJZ69 Q!PHj&džZ`ղ4ќV)Ttҹ/F aƮLd5kgkKCW4Jmc@S_ہsobɮE?oK HImIgݯQE9l>rLGjbEX-_䣌ɌuaT@}j%}?>!5$8@36BjUId V6b[zl-fmxG_ϫK&O?gEzctԸ}IVy疂ZdC+ӖBdFIi6jbiYC Gz}<\}y +@()Q9]@u^{Bsf]EE}U>\S%.p6h"DfJ5y53"2^} K KcT]E }ysjDr|E8Q#q]]a1y\vN*5LJ*ixcm&`+#3GTSTx*S$_4\)VrnM Tqd_c6⩱e;M%Jg@ \V( tۛ|F 2@)tВ}2X ŅRx~^0?FvbygCѦ뭁[ʬoW)KCO+yZ*X/Ne]D[w.RVq"&%o hn/s3Ҽ0MI>u=1viZ9*jE~C~Sl_]G αWSyeƅϮT̻ӅU`A4dH^ИXq uk\ukV<_IZw pS?N}sзz:}WJUXj0dt` $e8&ldipJ*@QQDvW,[L66>Ny|7xXxS5'ug:wpd:jX "KF%DA}2팦?-C9/YJ %/ԅhs^o&\4Ԃ?N&(bjFAQZ|.-՟".vdZZXr Tƶ%~3N*5ܛ h'1SǎA9xKUZ@(EjoV;Uy B(hȥ9OfC1OۘM76Bos{y[URE)J☧NͺLI5Uz3XZWJͿ9%2)IcXIN=EDVVB$U x ]w6JzW^dwEYz';w#-H+MeCMPE˩"A,h䄕!(^{A?:yV\z4KsWٕsi屫s5ɸ|h!!OkWO?Iy"=_$; X n?ڧ@Bl[ 7fLӤd[y?C咿RcR~} 77sC26ſ\u]5;׳[ϸNƓxW>u#Q'X9r} [>b XCÇL_.ɹ<Xh[BogdӮV:KIxwk!7An?8207T # 7,_zzuIxӢx@*v`KyhCtUUv~AhUY{f>N#!z)~CäGĖj>AzAbES$z枱CVy)wdh٩rF_%01[ğ붟c2- nc8ZǓ\$ &j ؑQ.)A+I<8Kcs!m!H'MZ(Q7F`Y6_W[T._)5v*xI9Q!ݷW\DTVWUp3SVUOP۲}9i>6ۑ)*ȐiPC^4 >.1׌.@Օ5`=qiUWҖ)rTXԻ9# * d+KKO'!?E{g|/NGE1Xb7TaX? G06P9rEֿ>ɮ.~]7d;fMrw0V F[UHuT{\ !ۋ[_^(~]4;BUi_JMQn긷rZa~[\Q?oZhKq)>ۄ@X; .O?nqaucxŖ*7'n#zЋO sl3 t kGun7Bc$b`JHmn?4H4{_fxcBiY`[խ,du.>Y (NvVG: fn}ۏ{kavTe*e}Du*B7S5GUw0<Bsŕ֩cSLksjnI8o$+7jtM@߹$.TZyC#oa{=mb1(*/ao@p?5ϐ]X-ѭ|.8t꽩=XT:]q~?7`CmX44pObO9IǔuOPNoM¡4eus}]:@;{n,lmǻ,yï/_uNdǼUIQ_=;/A񍹶]H'OV~Ϳ޽A[@܊E'mS矎޶Jr~K-xFAr'B'{r˦VjY:b4m{0䐊xYTjA~n:Yٔ&f[1@[W=]Vsz7fu=Փm`QL^.fҮf$m{[ۢ݇NM~޲CM 9o cۅ.۝hV@gFGMψ-5UGr*{x6gSCE31TIND/;#X[~K&"-[OjhEDW10Oǽ#EY4ǟzNAV"tQtB5_􏿠Y!a86[}~KIS.V5kA`7ޙy+S_.i|AV*Εsn֤_4S^ځ>KKhܑ߮Yc7A?7ս1˿ۤcܒ\7:{oM˸b3`m}W~+\G?Qw/m>5@>skH1\Z(᧟zcn#z?Myh{~oTK<;{6B#GɩAcuXbj%šWҟ/>[\p첢V3N-QsvM^]մ0-Tb^xgVCWF2i@@R%.sYhČ򧯞2TzW[o^gTYze}6qyJcjͤh&}k%-C7J:Wt`TQpS@ht)̨H>ؚɬH 4+ˢ;۫ 5$+o[G^|Ub*׸4ܱq'JX`WsO>VT>hk28:GK#e?;2C ?smeML&IlqT7S5+6BEAZmnJ^Me,{XaZ28[aߑL_^;#5"14BcFsvbHu%]I9$0R~IjhPF 'to%ϊΧzGs~bw')wdеL✖u@Dn= WB#ҋyZ5tu6^~ǞI$j GP_ _tatnFlCs?>vg qۦVQ'y_HCT:rxj5,?+.I'1F*8[#ouF&;Kvg2,-{Urj/Pvn?ok>|;M?}䎍&9tb#FԚOc9Y*uuyxt_p^2p>W)1x[{=KG,#FH2,)Zcqݙ;ɴy6&M0Qav)+ūJI(M@ZӯG"G![VJ"Wq,x)*SM͉>S>zC>*nׯٚ rܾMX7#b??WFK^zXj{~>ļ} *jTxq;WIv%bKjH PtqQo'kCUihĮEG@r0$LV:ZEoIQ3)u+{ot>"DMD&PHξ ~to!鏝:AZZ*OyUZ2΃?5GCy/pwTc>|[GrZؿ,ml?O~8I;pѷ:_p%m!<*ËDX13OS02 _iL;F64>,"n=ϴ'5<\\X=&0ЅQZDti&W94o?%Qdy1u { cs>Sxa .! dI#I~xUj+B8z֙xfL,5t Ib,x43U?7XʚdypqJciSJRG7"@HW&Qԓ͔7rG G@(9,`yQ1B4 8{_N4TtZS`ާelJ\~>9:bayNW obxZ\UFNi+%&mϨ<}? GklhKlX5-b@cT_af |~[v4?j|W\b&2ڨzH|zBI?Mוr K*7\{3֝__eilG~6Ӊv:r°٭T l5qa~O}=&vI/|׌J8(㘤;j(:Z;mVWfBX!R鬭- W*/6#Qeo6?CYNx~@۴e 6>k*.UCs+@,olLө);m}aim7$6Aꪩ!50CքoU&SR0a~7 ~ʚ~ޭ|.Ç@6bs*,v@T`}<cq{{cTU)4n~Xp5>z׆;CF#h(IiC(WEq3Դ`^w:%eWׄbIJ 2=nxŒ52'Gk 6 !Ly<7 ִ(Y;RmTQ.10qc`/lM&xXj{?|V?H>9<24Di`xk2DȫK^F3\[q˒k8ZA>S ;\n9C:4:9 ?X"hĄ]mkOw/>_r&GqEKRV4[MʁaŬHA*OоYAmZA6R=z:ftOǕ{NK1e>=@z'!NcQդ؞y?[{NӞG?ԣcQXI_?.l}d8rCkoׇ.,UѼOSp9AQv5qv7G~ܟOufZ* L:PykbЏǾ8m(P7?Ǻ⤚dW1yө,lz{JDf]cA->2U> 577_=W8 iԍ"Ŀl EJ8(% s#?mB+޵Ǭ]UA!dp$ }VF)%}xg2t)cK6ҽX tB/+h"|hTBl9&l^ןm41 `cSe 8q`>K~/88t~}i>xI`ĽXm{[:aM) ztE V<#ң-l"T2>ʱ{J.ty6&jL*)IHJ1H'Cd))SOF'?֑&*g~v+EO6t(Iơuse܋#iV i~M@G'#PWϏԏΜD I֒U ~UmKXq!POF?IYYWQ:v7{pQuYNL@ *S$K]2l)cVɲ9k i- ~&GCN׭5n&:eb'žeO\ KЃr= NP[>74 u$-k}K9?ݗ@ IO*>ixxG4HkKi}>u6܏>NWIԓw_ϱOqx ٹZGcҟh},ƿPse-ONby*V5I&p݉D$QW 8a_ϵiBsx_Y?ՎʲC%HAiBu0C}, A!X;2]*Xk'_OЩ 9|WM'7ONMF ?@6{{DQ$)!AȰ\ONj{qci_f'[W[00߷se}?ͤ%4@p~<_~nTu"Aou*Zoej^}^-:t^->V?#?_ؐĢ?Fr?8tIx{&W,{ߟ?n O^i{^$#߳֏^ҳ^ׁvz]{ȿ{:" RIr]=JJ~yN?~@7a?\:uR},,na{K8 N_a:}D7\io({MqoC_'&+oy_'Aoy?uhGoUQc'Ʊm@9co{R L%oKh'p7 Oغ1N%E)_=F7c__==|ƈd:fpYk܅$2MO(&F?[qo盏i%?3ȉ6~ǖ3!GfH*$Is߃֋]?ReeExÌu-S@ܔ^{.cr/czn/?_]i@^{CL}8jIRǸOoyoTgM(?C/P ^-so1:jgcq}c$:ڕj޸u{kQr[O֝zL]Kd,lGifNpᱸ>O׽/krxU9,|=z{V@iP5.\P?A+<>׽*>~}-K1^XP-f'TC{<?.??׽ecabnEu|U@~μ:<}V}?Zz^[A|?{)Mux&R{:w.8byo-\!Nь /yTNF3-L2#Zi`P>OKX=ѱh{Wp{&)aXxܿRUUT@K*r`֘rFkъB)R\@GꊻZߖmqeSIsweS?ef;k7MF)R4"1*UK1չ+>Q"dIdXR=3PEqA59:ܮ%2(:TUl#~ޫ~{ϧ34aw6ۓo$j˵:30gAQFÈG.UD*/ <>+f m򂊆^O)SS[e qf#]LVd,diZU"ƓB3P(M>07+SJ152<:({|V&6ݿMsrn TuuE{5qUU,q/SK"G={> M;;vJEx;_+%ZZZ$ƫLѩy%XRX6*AZHI3Pp8qEVC,*ER[GiG=8)vJ鏏?gd|t}76m>LܱmY%=M]ry%Mxj'z56L$hn>inTC0dAMp4&o$Uu6x+3eD(q-JlM4Q*ڥNCrN4$%*$n|MP}ηF ~Ts?>S`~xl7kz̾Z []ř"!ko%= rxl5SL!^w妦>mǼ6d gmY%;U1gH*V/;mm$XSVq}(^H]!~=A5J(a4v= UT0z&(&zd%f/>6o}!A[44 Fy#dfk U(F ӤLjy ֞_][?v^䣥]v7k|E,iaTLXH.#7b,ː2Ic);FI%&5K1,xLl+W9NxN~ $_.~ɤRb6ge=;δeԯS%FH%ܳKY8iJ@|\-I$$>A pS\iF I}t}/Xl QkA_OƼA:!\C8>N;=*b#7n7%_4ۧ:;f{hTST!zlrv{#TM'13TQP-;5QNh!B )G._B>߆it)oݣ95y@)ۖ:^S[d^(ij`+{+{tI8#%dP]EUf/f:CB̚ygK39>fCʙMybOڿ.ݼ@h:GaJj l5|ӛ*|UWN#ӝp/ 4xluM<j"UJ &钡})JC _7fSJҬ<>#Ƃ ` P{Wո8v:1I+UyY!lD.KU z㹨*)K B-0<:hMO, 7O+,lj8yWіbE Oˆudqu O/ JǹTa *yi+sXaN=O8O+^|oX(R8.%2"/2k(O5%3Jj<*L+O6ddw~Yzqװ6Z*p!/Lv!Rb+roaA&ROĚ棆BC:b^g3oHM\a2;'41T(>Vb\\R2|%*3>| [iJM EW]uw>Ώ9 w`8]DST5v\#M^ߩUڬզV_Phby T?p~Esxe@hMk'?oEdz~KlYǰTY OZ!YH$xƒ8)^#%Jz[LIkʠ̞O*+\Ќq&E?-ي\pbQPSeVB MX֖}%(IK^yE3)x=.A ܩ7}Eh%5eV4Jc@A?<^q'/ɚ ^J# XVge04qvf>H#b)f H>IFzT&F <?ZT~μ*i2e?gqm2YX#eUY?2̊\d\TT5,zѕJ ?Tx yBxz'uq8Rt@AҜI?C)T)RaXO',"i=&5L@r.H2䡠^IbϫJ+$1 f,߄A%ْxyAhu>E"OMQ=tQڢzJZZHR$t 'S+*;8pswn2+ME:iWˠ]9j NrOՠ| Kt5>ߢ=V@m}"͆dΟģӮy`5'+-EəՓS,r!S.̩p=A&G,qPT'?Gz*M58e_ˠ,ui,nm풨KOU@%3M# Cp{~q>UIGҴ1ҭAt懲NgAtذS*Tん¼_PR fmϛNs-, Y/pYP̲T6Ks%:M SLlU:j:Ud̮Þ\Dk#T5Ll@Ү.PAݶ|Ko6dZ.oq͐Zg!Gb@#lOOQO< oRM~TϗS&h(<$5TuNAQ ̱=B:9ۨ 6OW7},.V/o*i^7.[ť.|C<|ьxg\ˇЃ^gְo݉9c nQ͐dd:NIT㩀].$$\n6_}}\z2y7E??_=FoZ_O|dlx#:뒎=1[ϽՈY=C+VWUjs`ӭ!{??xʪYG>NKaGo~'9~=,?8u[xQ#M9yy6{uakSʩ_$ߏ^:2ᔩn,ב_W{ny_ u \{Nة{=m;~θHl}mbϿ/|I<[WQǺӪR{w7 F?ֿء/{-# `?7^k"SR{袗,4XY Zcx[9ڹjF@a^Z\'In$l*(rʿO񽽎;)C,bW'?ڈӬ lT;NIE{p9AM4iq9:m&9n*Pplib??o>OzCCꇸ\!M:XA$A!$+"8<_ZfZ ^fby>6mB*!ƻ`U?v Za¹5WۈXqsao#>ǝd#ĔLYb??~c"5K!5ww971$u49:OАG7XWn=2;o5W41zԲMjR9؛gIM<>oMO+ + |sl=׹#mV偲t -8C4s(9y7]NrGᏞuqrOy(^OvnMa^[#wVnM_÷=((̵#_cA{<2)nyߓ}=yNRGE:#.vJY1̭ak=]ӹNv/\e)UT(IM*RIP[5ڷM85z-vpDd`zRbty|jJ-kِe# 6G. ]Ŭ~4&O)z#dXm"?yF|*3.Q- X[{MA^Zz}}'9zWP-oQ='=ƟͽԻXu)6>騊qէSC\#\?>+ZGBH{H?mí=I}67'}"Gj krE0ke` ~y/kItԃ=p 8(mVp[ qcϷL?=zp!*"-ro?WEWCRUS9HB"iR@?)CT:fIԭ~T>RR%`BU(F ʎ]oPGՊI9c#qQ2AЕ4e䨥Po"H-.̊N4LH8E+rvlvNBq2Ӷ?%K:# unu/QE%k=GJ,F)ᯢd%.JH~HӪt D44ZEɯ29Ln蜾uW۸ik3TrS:jy2i7 ouɄm,K3) NnXY :i#@zf[K*SZTZyut;3'1_NV!!UEE2YzJxrPYMOKO4Ux-&+LIIHG?ZCVO5}:SJPC~&-{C yU⭨o@`>Q5c__Wl5ǩӋUI-  c=W<|_Ϯf@ԧq}٧ؑe+x*1Pb6><'\Қ@V7-od{fYEhbq@M8U-ҙ8 V :.::yޙ]TCFĽj̊ߑ!ưEKbLlny?NO!8HZG_L1֨5#mQ]I,3BФ򂌼 /=D9xwu$HsM}OOOk 쎰S2mPDs=5}@]O{'Tff_i 4޻b}-E>6bc+b_,.h~sZL3T0y[B{aFKu J7m??@O>Z` ujRT.6ΎO`##1úK) ֿЛᓭrPcKjbd i7 X(M*8y+I/:n66d$Y=N-u8Rډso1S3E:F.( +^mdsƣ:ƕfTmMKk llx?_|Z$ an"Apu/GC8i¿gzy\,O?Ͷo-Y{of#'_Q6p,Ce@EIx(E'[@j)LW7̭HNwa Us1:Pw'6a%: ^n5,iÇ1X?F\?Ϫ&UW*_W\}hE2e`l_{}H ܁|}{p#;! F!$3(֬iZҦ8Y=ϩ-XnBNYMPEm[ecc!!?lrIo|2(,XcC^_F<1E@V.(`L}?0eh2Cmcei{VGID|3Lf}*1$U{uҙ]ca!l`#zl.?qm{=kě~ܪU< (ސw>z>hm쑴@nYD.C<1yX,}M@G+g#Σk&3,]Aa%\Ir ++%sӮs\vߒE?Xůo>i!qQCkBzw,ytɖ]#v@el&@5 uTcp7xuC":Vy\zi3j&qG4[h5Xqnmck݆LM#=+ Kv[uA ҇$:ә<̜Jz ELL?%_R}Eұ'6ɷn0t7QƼfq+J;tƿ1K,˱DaL#qm[ɩ Py}~S"ښgҠ \^ߒ4'>FkLJOsq.921K=ѽڟThAXE_*mg59^t )*nġeiʆjqgKiӪhc@nyt?_M32"wEG6wdtYBtT@F#1&m_OORj)R8]x$ ߟI{Ӷk$FzXq=U&]eh"b7o`x(fEG 6vFUNWMV Y*}v4crΥ&˅J( 57ө}i(hTY7npL@50i5IM"LZL[~޽q!ç'p>j7^\_xyyLF>aZd>G7VM6&Jl]:;"P%-nF2Jqg<1֥Jۓ^<|v{w.{ hK4 *`KG@4tccccJԘY C<pFܟȿ2UA:|+pSOxf*2|L) cP*hcc{i`2UʥqGR$Xyslk:hE|ÃI'Y}5=n:Ux1NQQXƲFu|{}݇*ɂd%[Kً6価Qh+O,}4#\z=K|B:\z !<6optJv4+MG*_>Ī >tӶ%hNHo˫PퟰCg.ަcwYSSPҪ²d6Tui.V;vt=Tyk E׋ dtbk7C~=]ltbUZ_}8~]-Jv΂ߌ#`Z2(~ou/]a9d SZxnTXӳ2^A8*E 5GkYjAU?d|u;K}LI"\6CBse5$rS <$cE.쮶8Zg& tsC0nlQE.$U xU<8tdi_=p{7ώ!p'(J2|6B3 T+M3W 5HaR(>+8}Wnm|䔍Ir5T G2.:VK b+Iɪ2 Jj雛!( 1E W콙on&jD58X֢./ ~ؐ+oLCMO}eS jL",4jdJBcg*FyB' !GOPtİ*I Y pUOG ,O-KVgmIZ\qeYM1GKƇү%SQaȐ<,?T_vYJNAFmNI-`<# -~8 O1թNɮcEN9s>Áe6O^8utU5Qr>9_v5L-7[}W3F .~YtV*+-CMplNmcShn#<_L?9TSf˚ݲ%$;!;!I?uTcg_,bl-~}[Yb3Jz-gQP:uL5j(xZ9MAV.m6[{*KQZ)LU$߸-k\MWo0spG>MrxP|g݅D\l84,4uGy5ӫsP 4ɩ41?ףeo["VX! !5 %?'Q &W{Ia/A<03O?\?Wy&/!PEU!X\i,O8O?@B\%@-vAs`GǷPӏ6?|i4,GYyQ񬟥u!݃X ~Mek< ^{|?W_^<&(³ _Ha#ĕ/st_}=?RmGF5Tbu+u1,A6Ht [.?ͭ^'4 uj> C RkJ)b}9qkPAVS{Hoz?UWSK?%c4RQrr>$ Z4}yU=v%kʴr Hu|jR?A~=YKkeUeBdWNq瞷SN=HGвXB=$"qro'gR9Y3O0:5\C\nїV#.ADžr vFt^,m/> o^{u1%KR!1e?-##7οQ z:.ߦXI۴ ӫ,F6)cʰrA7KߟxZ0S3 <ޘҙM>]L@@DWgM Ty|8A!Ha[+ת@B$o2{ 7h,HoqbOp<㩑N*Iƺ$[BEec}7,[~oſ؃1_.V#p8Heqfg$K"4plp 0THs'}ͩON`5`]24j6]/x>_lr TPp5k5؁ŀmnM8W>Djy0.:{vΒT2o<`#}7XBnySe7Rf,"T/~X*nsog 5xSƙEN Z|iK>4a$(-W`H<Mцi /@=^ҟ#ω?9cC}WbF<Ocr+ Hc2ѣkb~>?N6936Q'3uadK4f.ҼzZ][[[{& GOwV\lAl}W$z)XmLAi*'v2p? 0 .۪:AS$.jE k\LҧtuSO!S<*Gן6 p?=%\b}Hoـ5VcE7Т]G06aɐNK=r~?,bÛ_? L>g iZs1Iޥ[Ȯ0Fr܁`JkO ZX9,_˥U-,Ot2&E~u5Ǥ>0Ic 4V2XBl=}i:ex=H4`/>\N5]ulH#xҎZnA=A9)!qR&@[f6 i G]Xj k{oF)NT?nKB: "hT]BނkkC7| hT2FKz4rH{RQSA#Z<t(!@bJ.bmaO Dhy}WrlYxk_U?ALRW76:x"5eUH?ǵ(`[Þ?U6z}:E`lFѶݘ׭7N"'aRe\-sݔI={`YiBeuVROewO!~_k-Ҋ?..AfӪ@5[ 3H_/Ug#Ɯ>}w P'I?_T+nh׽C:?ӛqoϽt^ɧ{G܋ 'ە]{CxP|ʢQn//_z pDW{$1Ղׯ{. 6{p>JzӬAI =P?a| :?Ib'?q{'13tTN_aAȇ?zmVLx؞*aVB߃ayޫ:q㯩f[ғ8㳆OPm'-MDV1ZD#1"@?$۪PO_:&O:v Mi|MrLٕlRBM -~05LOEeRnAQ؟kZ|">`zcV&;1bv#,9RHn* \ڤMJSeV\|n?;`>{~xf#p.= cV>ڍ(taEBS bR_aD] }V7{~oali?x*c)߃?rT}}7M?-(pyPE_A,-m\}~kg~]K^qkؓ2:7?qmdsqc{XM+׼>{E$XݏjNJg^pׂr?o?ӟ׽gJ{՞)R žG7qߟleAOaT?։ӯ{^5\ߏqAo>؍5qn1׽//rA?TӪG{R1O|z|~՞8}m{+G?^^ֱ?׫={Jk_P|Mֿ}{G< &N[I<~^_^HAҿ^ {b?tvL !Iu#>'>XFZ5*-`}@oB-hGV?^ws2fۢE۵OS_KE#D&AʧiˬN^x2P(+C//>f$z/2a:GI0!p)qje2]QeZ36cHl-yv2g12[ a4t9O+I,tS\3CJwqҀW`׍1˥(XQM#h3Ǥ~?Re;NmKGC"⻢\KU-~*d))!&Ykf 2IT4Nl%%SRdF$e13rA2p 7RvQ;>iڢ`H TIpTz‡m8k9[HbЅN1ʤ>XСK=[5ɶꍻ ڪ_1>*ȕT^ɳ`C]76+x B!YSNI*tIe410)jKP=?/<\<71*JWqǩM?(|N-zh:9sl~% :EDXyE[S ӨOQ2'?>#p/{gk䂄KM]5EDٙ°0<\LÂMnRj*$=JtjBg+ _Sڥ0?Ϭ6n#qlO{+VScq0J?SP*SjF.n"n<+]YSMe@)d& ,r$GD`}\#>d=+4&:3hDT8k+qJG{ WZۛϸϬWem'qg7N|J"\mdVG$U+vc(7%DՔxy(R42F#X"ލ- 2pL ~EZK.aQN`yyP( k?!1~|C7)K7n -cڮ9螻)T Ԣ.Xcڻ/+]f]W7b㣧M*#!chjAC@P308?ޑ[ܤ IaS?>CGYn=c:Sef>-:oSgTv~2=6eZSJSUU3F™DQ)l\5,YZv72sP&ҶcQ׏e@|-Ѕ"`'bԴ\ jJzӇȓæR%V$3yfZ@Tä=^\^voj6pxUd0Qm\H44UHk'7m=FibvuL"`hbj4aIIZʠ_^/mi#ZtVZ51*Ꞿ@-[%SLwLâAw)eVV2i3)GO%+, *ZP^ݝ<@IlZ?}8jy \јn-ZRu:,Uvg% ̽Y**yLf8&pdh¬lƺxSY!.J\\<}P o--SL@qqcW3k?: >˞!-6'q6(X-w$Qۗ#AdkPQ%–}-&:^4C}"RU~lԛgi]ߺqSe&ߎ^uu+,e7dԠiJGGESLaK4^gP 9~Rf=:'8g t"ܛne\2vn:\e3&(WLvO P~к$3fe9U 3s䑤X>䕯Ȟ7,]A_q]WGqSxɘOkZMQ=9zvv_M:  DG,&٨$-ph8`|>Y . (=xnKQVM&fM1 Uu|>I2;Q!g"2@7rGHN~RV:BB \?dFz ~ޛQݞa1GB:lV}y&Bii1I76"KKЙQـ>M 8Lv&*3sQO[\ihK <:#GjcNKirP*0u%~)[P4? ~@ vpnX>0i.TA>ҼrJÕH̎|QSąnL^Bխ{-4<#@qF|F5:P'v>>r.آY%jճE0*G R$;5Zmޣ?B]:Op_b8ҀW#׮ʸ)ϑWq]w-όH9gaŖ8Nκ}`8XD-U8r8aX%Ud[z˅oU#Uxy!>G)s{I1G#5x0Tv1-?PUG!pwhFzL=NTwIP5+qv{UOsBN\~Α?/|tyDxϲ.hXw@#&u.k,&9!:@Ru;OUǴ PT2I>^|A&)JE5|}sJ?;vOɤ29jL,F$fRIe n-Ȱ[NR $r@=z⢇θtyH"'|~Dg W+Bs@q)\/jRbd' ,ڎ }o,(R2ݴYx5WFc #UHU~S&,O42?/ˇT-)<8.yMە!mm&U E3>"o*Y㐁oqjoصUsGLU P.TtUA'۩}zA[z楇Ϊ+Σ.ؾ7͇8wWeL;wXI %Vz)jcd j)7c"x3$o`ʪkr5uP9_tHA^?/;iٻzjp{˦f&zF(f1ƨ: EާQpѼKi(r ȨB,Xkݏb{3ȨO |DP5W?m?IەauM#Wס51ɑ{ΓOZ4pAgk%Tw!Y['S'i*'DM- @qGtmmv TC˟nv|υ ^墧ӵd3ע| 5:qMY}UxvGgVw嚱fjꘪXע3#E$TpSꈲM3+atuT$PV$`&s}9O.|+~"W|HnwZNZǘqi*utD,HR45dt12Y:bVWU+"YV7dT*I&.+*??ќ}UUsb*?/zTJjo%5I0*1QO4Ut~˦Zy]HM _}a'Դ+T=G5HQW,hG>>L-$uWŖWdQBdq2} ~O',J(bus zD`BvDQĄ ,ŘiGW ~ϙ.!-Nfq3kʪ,@EU^FL欣azx b̿Tԑł9G>&jh&|ksy2h*QsLPXYT7%9[#uSuoY.۠:lV>EsVeOp-AGPt;s<Gk8eX$ X,?&C~Id*_dس L3FbLLpWRYBк=#5uanJCsےUiS*qᑭM M>qw ȺhA˨544iJ9[16 ]D`Lā@I'5%vkbb?m*v^ QQn,zj>AIA%UTp*DPFLݳ;.e|ӡpDN_b6RW"Jo^5lJXi?n^OG1;i%=mvFdM@t;Je56גQr*;3]vshnLRc7W3V2VU̺Ԍ8aPu/+tN:)ٷ7;heisOxqmg(CWA:Yo כ?:y~}5:J r@"㛁7Z$no잯1o<}=!C(-q۟˪ͽmdr/rEIןS˭߼>s͹[{NxFs㏯׽uUoxnCy>$GWH$9޼:4}3ibSp@SӟϿuE _UϪ_?~װ1׽mDX?PJ{6.Վ>?ٰMr>Juo :U‚A_~שZ?j~ν$Zkz&S^ rM m$}9[߫NZuno8yX(s8Y<~-?j?OSSSq垒:4tk&:Im7)u+V>~y<[OGJݻ>O";z@§R۝׸܊Z 'U҇@l~V^ G%&#گ#x}xVo,uqIJh<}8(-0 #Ak[ѫ`o5>;;?6w9$?؇t1a`Q[cks?#jONcd$XkV,$>Ņ'ǀAaHH?&NOJ]_Xw]kب<=M|WĐ  rcĉuii i), A}~hl^-e3,Q7 Pm~ڟqwI?hny~^6ӛ]LCݍu>oجxk_hS=IJݣIy!%}W|:mlHW@͍϶NÚbil'oHk_˭*Nj0TUIEW?Py{v~e5f#IE9G=^W[*̪Hhj$ #ec䌗-J &|2@1z,7l=N7qy]QH|`fjwrUkwy] CU;vf>(3p_$7~)Vl=9ds^u$H IunS}/(%HHQvbNv'bI7'p+eК9fݿ ok^x+=悊a1h*`'}?g Rs>]pX*'P$wg X<^?'!!F(CҪ+M+h?zV]Y{am_IFl.O=I Qoc%$cN4QQv>Jq oq  ϢE[xâiG½Qg>1^jJJI'v-+6=D\%vB+qb,ߎ}c?ʚm:r])䩩OL6$@ OG۔}̺noGf~X,om""iQǯIkQ=%]?eRΞ[cSx!qwWe<7 N^0#!Г4+g{G?YhQ R"?ڟ{ @+YϤ/o׊C8czc 3|P|9Y"vvvU4c[Ur8 |2'kuh"f ~7<{O$#?6,aON+ WYH[*&!wq">is?OcN*c OBq[Psl-p Nh`Гip)tGHDk1[]?_joi~Dewjꋖ-oGQoio\<ֱ%?S3;l$rT|4醐o@,l.>f{FzeijYe@M7bU|N@?= ~,unڡwCgg  5L^Cnē>QgŤC2(m&0l?rnTf41jDԝ#.tHٞ۹"u }GŎIB3F5qxcoS5ƍOPlz_sa9kes? {ȠPdASQ$?OtMxQdtګ-3[<UJU`*n~o[9W*LcGlQ0OO)r7>pchIBTyX=D\}m QS@~xإ?o-WX>'uAUX n>I!>Ow/ٻFڥЄҼc_>{4__?L)'=1 *`!웋~_4Ga<_Gon\'$S?ղ£ ?ڬ_}¡ꪊ~SUUA}^O>G?!I+(C !pF+ï} aũ髇=ō+[At8B#(A*؄{:q ;3<"4Xgh!(BRz.b'Iu͋^}DuA֡]u5}yo&Q^YCacn=(7˦d\nXT{J}],aaP OX΀㚈\ܟ>!ֵ'Ȝ9ϟ]wG|p=V +YK% Url/{m%.6TpuF?R}qqЊ>`y>Q Vˬ`t_Rh(! IT"\Ցv W=.cJFKNu^x_"5ƪаɯNzJ8O2hU8$EBϬiiY qb=uےdA3؋ ?KZCئϪ?B?Sŭ_ea{*Hޗq`12=B2YBE?OZV$֟}+1~3vЎ#O9F $tju1{kq9rڄx%;6!d0?_J*_˦ϯ[mɉwpu1Va,> DWƲ aƣo^`)NU$ #x;`wGv|ʥ/udԕekWյ/.n'1w)A$YZ6HU^6rGF9sԯ"űU[MK%}h p f}8d5`VEӯISE-޻oܙV;O5gjLlY r3ru54Kq,txM%)o/3TȑH?^G{eRk:2(Ikѡ%d$>o3<}^$*RE1mr'58*,&٧WϦުt x"8%jR?bZ>},hd*VF)o[@؁ZhP ٸ?[R]1f$FcfuSH ?7#W~ҹ~gc8tT1-wJ>B8 qېkp+aC!]-c~}"'Q =?>^f3"H 5U@'Hp4G- j<^+W3`lHfe>;>o{QPi$_:']1?[8KkZ=C=~x%"P$e?[)ȨI5.3:x*QcMJR޵?7Խ6u&7#UQ5NNZ1Q4V$w ȧH_'ڻ IPTԁOHQP=Oz~gw7: lNd4E]=KQ%3 ċI>}I=SOef75לTr qoaiܽ<Ph|k֘P L`{kyi5>G+6&@"G}mJvOR!Y|+]I"쵓RPV0kZPH>ޖ~z:- /0K ']lgdpt"<BE{*8K] m:kX q~$t╨+b:Y.xC?f`jtzd:Ej>~",zqЩ-€ G_G>ywgzNPYXcW rE‘kqǶj[GamF(8_kU|U ?oXe=:ҝsh[ODX}mǺPѰ0ʈAl܎Ҏ)RkZW*Rd< 4#T[Rx<esuQfP"ȰGS?e)?N r"٥}ZZW齋Y EC'2G@\-o&_8}?bO$Hqfhٙnp|al8H?{-f`2d';_:W#"hY0VGs}8Ů _oqȹR4#UzsQ YjY2!O7ny(0UB-u~8>Zׁ^c̟oT%`=(TP:LxKsD1@֘nPl7 yҞ^{Y랉?z7 U |Cqx:~"Îo>_P=l c ԓg)"U3,4\$kε lJ? <*<W2̚KA+F"tŕʑ _+/o?U<[~݁AUp5zZzuPqͭ8,^I\:V\DIRG_`^ XXsi=W$܋@-{~?޽ԂzMRѹAUTkhG"vA$Ǹ*G6T6Pmfo[ө&Z!j$qvHcFtѮ9<p?|us!\Mيؿ$'a <)O`(Nyxvs_s2TF+jjk1$v~nH6KPNi{fMŘo>:҃J)bh &@[ @b9m%5^Ri*kkƍ$jh 4 ãѨ5\[Sqs>%a|:+ܐKϭ'tsĀ!߹uԒ얻:H!EUThTQQhk zO# caQi">Ν@`Ϡ#e;e@$.,"ʌפK{2QXqŭ{TtMic#^=5Tc?ozu3$*e`W"M*ܓs,6չ!1rxܟ\l8z'c|x{&u4pU$eU$+_Dܪ8>aw&rF?St=z:\~`25lM|ͣXǶ ,QY*adGg{0݁[{i[iV6E>'@=c'tu @\2je^ߓs39>id?gӛ}4e?ܵS6}[Yo3dbT _􋅸?NI>W~b\p֜WzJxF.̡:}&Sƣ$ERQ YI#4߮/Ed_HP.@nH {q*0„ҼI'\Ҹ%IVE$jƺMIabS\ڍ- ^{h)?GPYcX)T7 ˨Ά@q& Ȗ95F0?6ߏtj)XU׊*%FѬᙀtd[SZnaFD$0RO" pqOzZ9tΑٌYmRYckH-h"0t9 o ,@鲵c0Qҟ}v@.H_{Zl<3r U?{ҧ>6`L*ެd吟JmzBn[ے?>wEA$sf?=y>}>r b jM$?_g%d| lO܋,}l*)Ѿɾ:m{ Xs<cț+~lx_bEOt^= 9+^A?RZ텿G֤, '_S;G ny_{n8S4ĕ ߏϽV?oH d|DuASe~_oY׆eu i*$#fւ},CӰ3(؂y#حZ!hZu#iO\~]=X׽ ?N̞_{D6@@5.#{rG iO| ~-@W^TrM\~㎽{ߖOZQ߫^Zv(,.Au"G! 㟧&=ˍy͸k}yakg|.o N_>3iSRGWc~΃|CϬO&LЏ{x\>"SoeV;#!I$5S`呤oщ?B7  c9WdHzwM%NJ+2P'~VTRU14+n.VǏ$qvMi-J+_s֣rX7?S_UZjX ࠿~Y|tmeƒ͍}8H&#j=>= }lIhr,aܓ+cVWJnrlɷRyo{@Zs}#(&~-4v;Ҏ;s_z7+ku1,ooRqo}A{_Ti^j됰`X\]} asj/[J3)K }}ꤒh.Io?}Q\ 0uqXu]_bL K+O~>.{=lm@)^Ĩ8_?tnQG:E~y*ZkſҷTP. k?__ݴ׫O^Ö?Ckz-Ga|u|7$sQnWTp24dSUTiM7)yٛdZ}ԑcrl(8`Lrifi}EZgοg<:Mȓtb@tю>ga/vG3:߽vڵ[>\~Kq(pڌd%~VzI*j$#8=ٍoۋ.#dUEY[qSUSY<0BQT({HBڴP20?gD,MLDJ޵߻c_~:uoPNV2pO(ql}U 4rS%Gy$-=n֧ lELrdB8&F!A);U0Ti,.([3%T"EzF0GǢ7™w"NC0f9^Jw_Mj`O/% 7RW:tuu$M1K*xfiGNGG&u< ìHu[Cj 竧z,NQqPt@##Oc@j*kQ!08 /Q};z}75vh#?ҪUsi9}ȪA㩲crVVRck2iL~HWnG,£15|rxN-,aH ʼ}Ozq)syn˃,^淆5F"1, vpť34.~"J,uuZVsFXhf ݢ@-a{wt:I5^xC'W W~} uefi__kTnڥGٻxKb):-q0z-,5%DRnE"pJi6VzK\[Ljf_oMJuÈ?AXptV=KYU7rioZʺj`:J`XJP;6scJӘ9M XX?{ۮXF^&>4/7W++Z8A6[xb1ə["%wh瑙_]AoT69[U='߼}-[^tjgg6VbIqy𶋲 *eImn𾔞dkgf*)*(xJi˕24_Q7٭od3( q7 *NKR`H*cv:ɞ}xM=#_ƂJX(-r@wѶsfv˖DI;ů'ٍD#ԖYs**E=x,tgB+LfLjm]U`aQ5^-WMz;VUi#=l(AVxň EIT}D$ 珝Ȍ/B?gQ6ٗte~FnZwoE['BGYWQ$4:x1FrLq5dj III4gUU$GPy/sTZҧ:8P@|zF~u5Y:GHbA:jLaahX㕀6aC 7"0 CxHc_ҕ"e8~ڟʝGPp }48fvSٻca>MM$dHy wE&ZtoP4x0c˴J,G̪'MܐSZ#ϭ>P0\M+CQ^//u1ut R]GCd +T1tWK-)ҢP |`R#iୁVD` C 2@..>&*hN8q8R\PA"#n8Xl3ne$VoFf"n<raUY<>J YRu`'3$B1Ti&B QִȦjm%d7+P51U/@$QMj|:,ݾwd^ީMCEej*)l$iѪ4QeZ̐ $X$i2(I<.@EZ|u=SO:˅l>JVtC&55>Ic%!\Xf"ͅdY9(=z_A+k͵9CPgBK|ң)xɒT eLBLeN;/{2Pd{ ǔcM1 qA`ĵnwZW0l@>FbjWXPc>zwmK;gV]!UCn=8ATXIHX/-$Kz;(Pʐ(꒖8ڤRJ)-N ??J~ҀП?>קꝙԤZ*ϼܙ )*4 Za _0iC"@ TPMP1.~s_3zH?trycɅqL2KơP83jl*L.9!'TakJ?ּjH镤Bz?㩗IrOR4&zu`b}2D}#QMZCUa=-?_ѳK$sCYUu4SLXu*E9#mhΛ =Zf #@58T3mc4_MQ8'Q;GMOJGsԝIԀiO\P|i"/O6kfi4nbHOM %hchk۝;@)M&ݲD0M;zpO'߶H5~\Up o*%`t^5^gis#m]$ߖ\VMk ($AŽEb}qNuz6?R?I}.~_^Ǯ Eu~_~=u~?70_Jq!"rOGҽv/?_ϼ\qv~͍~޺:v4Z{/i|x arG/ͯ~}Z s{RQjqz/ kqC x\[MEQb8}{^^~<?zV{;Z㛆$ҽh߷ hc-I ]z>IM~?moS\rnlOGN_$]hg{akWa?{=x׽p}?ǽz:oX_}^9UM?#p2 3 b+}Gn1<}9jPzւ&{%]:B j~~iےvoxmolڿ|Eï62]OF'BؽY$TK@Nu`ͬ#5EԴ8ac"'gϦzAeFEdA-Ӧo<7b.PbG8<[yz18guC>G_Rnj*>J$jDB/ko{}ܥ8`u:dȿںF=ǭxf>=7vɏ^:: ب,^LLm|̮5|dyk`xrA &1GTׇtDUd{;3ܘRl%4oѫ:+)<3QON~nF?_KJV}G9F_?íɿXgNc,L{pJ8eml!"76}ohGOEX p/Gm֪$^՘Gb)/lۏ}GtdR`4_zDWm4cV?M' ԿF^eGk-euS龯sLCing'm`2̪)Vj7ӣfy-PT1'Q0+$VW!TQ>rwVmo|6ud\#oRSMII5~\lYHr ߛ6`nUF LHѬH܍H܏Z0kB+C̴"+tpz?tc/,Bӂ$FS)#E>ґlO?{)\:tʏXہf!A `N?ğzìWDֶkUZpJ~mdu=poKBl ՒES*3!/}-}=2iNO/s=zjZpaSC)'4tT=6# 9EonI&?ӯ:daIC\ 3z qk}n}EPcR^GMZN|HEx\*O cvpmG>t ׋Pӌ4DY,KZn:H}TWV@X ?sbQ^txRtJA?jnH4uE8}h=?J z7pVAHΎG~h}}M_ZX{7LU?ϭ y!\Hb/}<]mbnq] , yM,|u5ԤD)2HI{oT8 ͨ\XZ=DO=jLuT>ۑ~mpx<y`6'qE"=]z=?2=aЏntE_:O/}:iZ2 ~ 6Z߃qA}ZI,s# i9"I[^ߏfѐ<|dVRލ&k<o|`vW6?p?`uVJGˮeKe+k_b}Uf S}{(Odxt1ʒ=9.i>]s̲3b)2U׿׏f4ˑzj^EzHFv>,?<_q)*Ңd,Q_H^qoeL}*h~s_nIs垛TgLka{COW7HeU1ݗWܑok"qLyL -x#UIE]l]a1ᭇÞGWC9ihr1ڪ95R7r9OPiz}3NVPxSFN;ӊUZaөI*r-oJJ4wn, ZgKXDU:x]66/wjҔxf֧+[/o拘W[qn.G_ᵔ''jS16"-@ Y޻xnn~ӻ-bjpJjDM )ټ2,R".Fθ?[=f˭wfxi,9 5R2(oDFSNJ"A% *oc?ǟ~SCևK_F? 2>fp?>ޯW ^2\?OIO`ScrǿS\NBN5\ u?چPcF>Nښ!_G,p7[o~OA[K0E>طzT1`, }xgפԼ6$\܆7*~H7ǼޫߓT`WV̇ƠQ}E#EKAwqW㥜E2<욘 d !)>P t[i&kL\KlUUl|Ǝjxif"E1ڲ39R{(q<&kJ eVRG\Ք*TȜkRtU^K:z*(Y,|AXXmK{ b&SfXj]K)LpH bGA+0>^TǦaBA4?>'V[>]M.ř kZH#Xw4uwpl-Ȕ9z:u4rk<*,vVJҠ\zy[Rx5pSϏ;Kx~٘ U(vK%\#*岍ZZ#6v\}&xR}/TjkE|r; @PJ}=rcy2QX?en?<6NWIo-ηJ,/XV#!mLi64So$V7=hu!gݲ Q][3]F)oH\}x>Ѣg>?KS%>QhtIM+P0f2pj%؁6ѷcb7utJ,TxvqS>'/#s3*BB&:] U[G Te$כ}9!45 /Gji%b +p?W&-ĸ TR/'rl=V4CZcʕ ׁ dW3KY$Xn(鵋 ke#/oiC qyPn@_fRZʃ _ZNn׶J$[z0mUAYoaaϲNNJ>uj[}F7qo~4GiHWIAPmf\HA{HP@G,)@%D7?ǘzmkO~}zaYS,$RDPF , ku&@[ɡ2!_Jkzmm:R|g\R7EE!b4#E'%$hH [koRUӔ_.T)t"T0?O:Y ߀,8a5!I` 6<7>VUY]VV# ĝ@ A#{eWQ./awv\q7cFE !XN>~=Q I@l9}}?/?SdMTh-tF66r]T,ܒAğ"@~!_?ædvQ4 ɹ?AkI* iO>ǎ=ڣ'Ӏ>Fu?*ʷUIԠx{Ud(-έ@Xso{h?NZ1UdInC[P?W@7{ ݭ…Cn,9&`h3\Տ^N*ИM-9a6<21{x`$_ߑImRP=$~MNp>/u YCy#X_FIc'덓Ŭ HpH_u-QU^NQ.X'Ik٬Ir~~2\yP$i\ mg+PZu)McGl(ڀ Y#[ PMSԟGgDBnTg91e`t؁p>nH,#e'c/}nWM5Tz)c30\o|dIJqo{_JuSBz?4^~5FF-~xJ{";u:m}$TӋZ("ĨVW}px(oxʟzG|Ӆ;[P]<ޝ?^/coqX(P)t "Ãqqn RA)&Lf(rI?OpčJ)]UO@Q?O>g#z;E FRb-hԒ\?(CFono$r??{ep'?gV::ǧYJ$6o .$-66zpi(M%ՓSޒ ڙmXGaZ}&O,ǟ]KJHP!Qobo}- LsXVVEk^"x.cz՞[ ȿzqƘ<̋a0d7ac" EcaisB(|0X)dpA Zoe6pGÍr~_:"fy?iIܵlَ{ Huy4X,-鹷 EϹ%bxѼU38Q]U5:"*iSL>L|*2:_4LZőOJx>Uzu*PYH`Ɠ{y4HzF>uUi< ʒ ? U{ XXXpy`wzRxn@<0)U>kEKr91ҽ uVm)-2uMvlRK,k)F#HTÔdo{LCuիlfdV}Kn>`Sjʾu`?FknT=H7^ՎLAvR-{ֳdWsh(QoFsoϹfqc?@}p㣭F7eI#so~ܛ8{`ƟsWN ;]27}xijS+u-OtvS/e?-C:+: Q!n- ~%-pTZti|J~M_1Wpҙ2DJǨݸ;[Mi0.W,9?5=~.uΉ! D%E:ؐZը͹ }G>^BmA8g|QA,;;̚9KpEU'DeD WEq X\ɸֽhq5g)=Ez>4fI}M "*keu6/an7?O`>cW_V1!G_Qu5ƒFyZ]aMuXA㏕|'Zg>]p}PJ+:F_obm{ ^!<W?ze& }x]Tu~9")Td` _I"Ë0{!}-/Ti'7~2@Q=8X#VIyzGRKP礪WR\ibnm<$,+_:~GMW2AK"b_6ޛ+q=R$*H& posܲB}q=F:v'iG7yP9?Jڈ>}LӏU&Ū@+{"w m_PBve6}o{4MO_:(r?3ғiAb?Efɀڒp.56WضO(8+R5OoU`)?էU~=?x} i6f n9x peV͂Ƚ: